\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1013596120:

Variant ID: vg1013596120 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 13596120
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 300. )

Flanking Sequence (100 bp) in Reference Genome:


TCATTGTTGCCTGCAGAAGTAACAAAATTGTTTCATATACATACACGAGAATACTATTGATTCCAATGCAAAATAACGGGGTCTAACCTCAGAACACACT[A/G]
ATATGCACAGTACAATCGACCATGCTTGCTGATTTGGCAAGATTCAGGAGAAAAACATGGAGAATTACAGTCATATATGAAGGTAAGTTCAAATAATACC

Reverse complement sequence

GGTATTATTTGAACTTACCTTCATATATGACTGTAATTCTCCATGTTTTTCTCCTGAATCTTGCCAAATCAGCAAGCATGGTCGATTGTACTGTGCATAT[T/C]
AGTGTGTTCTGAGGTTAGACCCCGTTATTTTGCATTGGAATCAATAGTATTCTCGTGTATGTATATGAAACAATTTTGTTACTTCTGCAGGCAACAATGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.60% 1.90% 0.47% 0.00% NA
All Indica  2759 95.90% 3.30% 0.80% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 89.60% 7.70% 2.69% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 94.10% 5.10% 0.76% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1013596120 A -> G LOC_Os10g26270.1 upstream_gene_variant ; 1864.0bp to feature; MODIFIER silent_mutation Average:42.668; most accessible tissue: Minghui63 root, score: 54.099 N N N N
vg1013596120 A -> G LOC_Os10g26240.1 downstream_gene_variant ; 3446.0bp to feature; MODIFIER silent_mutation Average:42.668; most accessible tissue: Minghui63 root, score: 54.099 N N N N
vg1013596120 A -> G LOC_Os10g26250.1 downstream_gene_variant ; 1839.0bp to feature; MODIFIER silent_mutation Average:42.668; most accessible tissue: Minghui63 root, score: 54.099 N N N N
vg1013596120 A -> G LOC_Os10g26280.1 downstream_gene_variant ; 4377.0bp to feature; MODIFIER silent_mutation Average:42.668; most accessible tissue: Minghui63 root, score: 54.099 N N N N
vg1013596120 A -> G LOC_Os10g26260.1 intron_variant ; MODIFIER silent_mutation Average:42.668; most accessible tissue: Minghui63 root, score: 54.099 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1013596120 3.73E-08 2.38E-08 mr1533 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013596120 1.19E-09 1.12E-09 mr1980 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013596120 8.32E-07 1.78E-08 mr1533_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251