\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1013579563:

Variant ID: vg1013579563 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 13579563
Reference Allele: GAlternative Allele: A,C
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTCGAGATCTGAATAAAGCTACACCAAAGGACGAATATCCAATGCCAGTGGCCGATCAGCTGGTTGATGCCGCATCAGGGAACAAAATTTTGAGTTTT[G/A,C]
TGGATGGGAACGCAGGATATAATCAGATCTTTATGGCTGAGGAAGATATCCATAAGATGGCTTTTAGATGCCCTAGTGCAATCGGCTTATTTGAATGGGT

Reverse complement sequence

ACCCATTCAAATAAGCCGATTGCACTAGGGCATCTAAAAGCCATCTTATGGATATCTTCCTCAGCCATAAAGATCTGATTATATCCTGCGTTCCCATCCA[C/T,G]
AAAACTCAAAATTTTGTTCCCTGATGCGGCATCAACCAGCTGATCGGCCACTGGCATTGGATATTCGTCCTTTGGTGTAGCTTTATTCAGATCTCGAAAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.60% 23.80% 0.89% 0.02% C: 0.66%
All Indica  2759 98.00% 1.60% 0.25% 0.04% C: 0.07%
All Japonica  1512 29.30% 66.70% 2.12% 0.00% C: 1.85%
Aus  269 98.90% 0.70% 0.37% 0.00% NA
Indica I  595 99.50% 0.30% 0.17% 0.00% NA
Indica II  465 95.50% 4.10% 0.43% 0.00% NA
Indica III  913 99.30% 0.40% 0.00% 0.00% C: 0.22%
Indica Intermediate  786 96.80% 2.50% 0.51% 0.13% NA
Temperate Japonica  767 4.80% 94.40% 0.39% 0.00% C: 0.39%
Tropical Japonica  504 58.90% 31.70% 5.16% 0.00% C: 4.17%
Japonica Intermediate  241 45.20% 51.90% 1.24% 0.00% C: 1.66%
VI/Aromatic  96 60.40% 39.60% 0.00% 0.00% NA
Intermediate  90 60.00% 36.70% 2.22% 0.00% C: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1013579563 G -> C LOC_Os10g26210.1 missense_variant ; p.Val757Leu; MODERATE nonsynonymous_codon ; V757L Average:21.657; most accessible tissue: Zhenshan97 flower, score: 29.832 benign 0.423 TOLERATED 0.25
vg1013579563 G -> A LOC_Os10g26210.1 missense_variant ; p.Val757Met; MODERATE nonsynonymous_codon ; V757I Average:21.657; most accessible tissue: Zhenshan97 flower, score: 29.832 benign 0.16 TOLERATED 0.09
vg1013579563 G -> A LOC_Os10g26210.1 missense_variant ; p.Val757Met; MODERATE nonsynonymous_codon ; V757M Average:21.657; most accessible tissue: Zhenshan97 flower, score: 29.832 benign -0.39 TOLERATED 1.00
vg1013579563 G -> DEL LOC_Os10g26210.1 N frameshift_variant Average:21.657; most accessible tissue: Zhenshan97 flower, score: 29.832 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1013579563 NA 9.34E-10 mr1005 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013579563 NA 1.06E-09 mr1275 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013579563 NA 4.63E-14 mr1361 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013579563 NA 6.30E-14 mr1410 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013579563 NA 7.13E-08 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013579563 3.81E-13 1.41E-50 mr1533 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013579563 5.75E-11 2.15E-20 mr1533 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013579563 2.24E-07 NA mr1819 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013579563 NA 5.85E-07 mr1884 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013579563 3.55E-13 6.19E-47 mr1980 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013579563 6.52E-09 2.63E-23 mr1980 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013579563 NA 6.14E-20 mr1156_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013579563 NA 1.52E-07 mr1156_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013579563 2.15E-15 1.85E-52 mr1533_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013579563 6.98E-12 5.53E-26 mr1533_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013579563 3.02E-10 5.98E-26 mr1980_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013579563 NA 1.35E-10 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251