Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1013579563:

Variant ID: vg1013579563 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 13579563
Reference Allele: G	Alternative Allele: A,C
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:

TTTTCGAGATCTGAATAAAGCTACACCAAAGGACGAATATCCAATGCCAGTGGCCGATCAGCTGGTTGATGCCGCATCAGGGAACAAAATTTTGAGTTTT[G/A,C]
TGGATGGGAACGCAGGATATAATCAGATCTTTATGGCTGAGGAAGATATCCATAAGATGGCTTTTAGATGCCCTAGTGCAATCGGCTTATTTGAATGGGT

Reverse complement sequence

ACCCATTCAAATAAGCCGATTGCACTAGGGCATCTAAAAGCCATCTTATGGATATCTTCCTCAGCCATAAAGATCTGATTATATCCTGCGTTCCCATCCA[C/T,G]
AAAACTCAAAATTTTGTTCCCTGATGCGGCATCAACCAGCTGATCGGCCACTGGCATTGGATATTCGTCCTTTGGTGTAGCTTTATTCAGATCTCGAAAA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.60%	23.80%	0.89%	0.02%	C: 0.66%
All Indica	2759	98.00%	1.60%	0.25%	0.04%	C: 0.07%
All Japonica	1512	29.30%	66.70%	2.12%	0.00%	C: 1.85%
Aus	269	98.90%	0.70%	0.37%	0.00%	NA
Indica I	595	99.50%	0.30%	0.17%	0.00%	NA
Indica II	465	95.50%	4.10%	0.43%	0.00%	NA
Indica III	913	99.30%	0.40%	0.00%	0.00%	C: 0.22%
Indica Intermediate	786	96.80%	2.50%	0.51%	0.13%	NA
Temperate Japonica	767	4.80%	94.40%	0.39%	0.00%	C: 0.39%
Tropical Japonica	504	58.90%	31.70%	5.16%	0.00%	C: 4.17%
Japonica Intermediate	241	45.20%	51.90%	1.24%	0.00%	C: 1.66%
VI/Aromatic	96	60.40%	39.60%	0.00%	0.00%	NA
Intermediate	90	60.00%	36.70%	2.22%	0.00%	C: 1.11%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1013579563	G -> C	LOC_Os10g26210.1	missense_variant ; p.Val757Leu; MODERATE	nonsynonymous_codon ; V757L	Average:21.657; most accessible tissue: Zhenshan97 flower, score: 29.832	benign	0.423	TOLERATED	0.25
vg1013579563	G -> A	LOC_Os10g26210.1	missense_variant ; p.Val757Met; MODERATE	nonsynonymous_codon ; V757I	Average:21.657; most accessible tissue: Zhenshan97 flower, score: 29.832	benign	0.16	TOLERATED	0.09
vg1013579563	G -> A	LOC_Os10g26210.1	missense_variant ; p.Val757Met; MODERATE	nonsynonymous_codon ; V757M	Average:21.657; most accessible tissue: Zhenshan97 flower, score: 29.832	benign	-0.39	TOLERATED	1.00
vg1013579563	G -> DEL	LOC_Os10g26210.1	N	frameshift_variant	Average:21.657; most accessible tissue: Zhenshan97 flower, score: 29.832	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1013579563	NA	9.34E-10	mr1005	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013579563	NA	1.06E-09	mr1275	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013579563	NA	4.63E-14	mr1361	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013579563	NA	6.30E-14	mr1410	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013579563	NA	7.13E-08	mr1424	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013579563	3.81E-13	1.41E-50	mr1533	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013579563	5.75E-11	2.15E-20	mr1533	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013579563	2.24E-07	NA	mr1819	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013579563	NA	5.85E-07	mr1884	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013579563	3.55E-13	6.19E-47	mr1980	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013579563	6.52E-09	2.63E-23	mr1980	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013579563	NA	6.14E-20	mr1156_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013579563	NA	1.52E-07	mr1156_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013579563	2.15E-15	1.85E-52	mr1533_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013579563	6.98E-12	5.53E-26	mr1533_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013579563	3.02E-10	5.98E-26	mr1980_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013579563	NA	1.35E-10	mr1980_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251