| Variant ID: vg1013566081 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 13566081 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 250. )
ATCAATCTCTAGCCTGTACTTTGGTTGCCGATTAGGGTAGTATCGGAGTTTCAGCCGATCTTATCTGATTTAACCATATTCGCTCTATATGTTTCACTGA[C/T]
ATGTTAAATCCGCCCTCTGTGTCAAGATATCGTTGCAATCTAAATATATTAAGCTTCTGTTTAATACATTATACATGTTTTAATATCTTGATGTAGAGTA
TACTCTACATCAAGATATTAAAACATGTATAATGTATTAAACAGAAGCTTAATATATTTAGATTGCAACGATATCTTGACACAGAGGGCGGATTTAACAT[G/A]
TCAGTGAAACATATAGAGCGAATATGGTTAAATCAGATAAGATCGGCTGAAACTCCGATACTACCCTAATCGGCAACCAAAGTACAGGCTAGAGATTGAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.20% | 1.90% | 4.87% | 1.04% | NA |
| All Indica | 2759 | 99.90% | 0.00% | 0.04% | 0.04% | NA |
| All Japonica | 1512 | 76.10% | 5.90% | 14.95% | 3.04% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.60% | 0.10% | 0.13% | 0.13% | NA |
| Temperate Japonica | 767 | 95.30% | 1.20% | 3.52% | 0.00% | NA |
| Tropical Japonica | 504 | 55.00% | 9.30% | 26.98% | 8.73% | NA |
| Japonica Intermediate | 241 | 59.30% | 13.70% | 26.14% | 0.83% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 1.10% | 2.22% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1013566081 | C -> T | LOC_Os10g26200.1 | upstream_gene_variant ; 602.0bp to feature; MODIFIER | silent_mutation | Average:27.168; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| vg1013566081 | C -> T | LOC_Os10g26164.1 | downstream_gene_variant ; 3974.0bp to feature; MODIFIER | silent_mutation | Average:27.168; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| vg1013566081 | C -> T | LOC_Os10g26180.1 | downstream_gene_variant ; 2391.0bp to feature; MODIFIER | silent_mutation | Average:27.168; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| vg1013566081 | C -> T | LOC_Os10g26190.1 | downstream_gene_variant ; 1433.0bp to feature; MODIFIER | silent_mutation | Average:27.168; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| vg1013566081 | C -> T | LOC_Os10g26190-LOC_Os10g26200 | intergenic_region ; MODIFIER | silent_mutation | Average:27.168; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| vg1013566081 | C -> DEL | N | N | silent_mutation | Average:27.168; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1013566081 | NA | 2.57E-06 | mr1248 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013566081 | 3.03E-07 | 2.87E-18 | mr1301 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013566081 | NA | 7.75E-10 | mr1533 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013566081 | NA | 1.88E-14 | mr1980 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013566081 | 3.02E-07 | 9.33E-19 | mr1301_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013566081 | NA | 1.64E-13 | mr1410_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013566081 | 8.35E-10 | NA | mr1533_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013566081 | 1.62E-08 | 4.22E-21 | mr1533_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013566081 | NA | 5.66E-07 | mr1554_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013566081 | 3.23E-06 | 3.23E-06 | mr1610_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013566081 | 7.46E-07 | NA | mr1980_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013566081 | NA | 1.99E-09 | mr1980_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |