Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1013543098:

Variant ID: vg1013543098 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 13543098
Reference Allele: A	Alternative Allele: C
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, A: 0.02, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:

CCGTAGAGCAAGTTTAATAGTATAGCCAAATCCTACCTCCAAATCATCTATAGCTAATTCATTCAATAGTTACTTACTATACTATTAATATAATATGGTC[A/C]
TATCTATCATACACACATTACATTTTGAAGTCCGTCCTGCAGCTGGCCTGCTGCTCTTCTCTTTTATCTTTTATCTCTTTAAAAATATGTTTATAGCTGG

Reverse complement sequence

CCAGCTATAAACATATTTTTAAAGAGATAAAAGATAAAAGAGAAGAGCAGCAGGCCAGCTGCAGGACGGACTTCAAAATGTAATGTGTGTATGATAGATA[T/G]
GACCATATTATATTAATAGTATAGTAAGTAACTATTGAATGAATTAGCTATAGATGATTTGGAGGTAGGATTTGGCTATACTATTAAACTTGCTCTACGG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	76.20%	23.60%	0.17%	0.00%	NA
All Indica	2759	98.50%	1.30%	0.18%	0.00%	NA
All Japonica	1512	32.90%	66.90%	0.13%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	95.90%	3.40%	0.65%	0.00%	NA
Indica III	913	99.70%	0.20%	0.11%	0.00%	NA
Indica Intermediate	786	97.70%	2.20%	0.13%	0.00%	NA
Temperate Japonica	767	5.60%	94.40%	0.00%	0.00%	NA
Tropical Japonica	504	67.70%	32.30%	0.00%	0.00%	NA
Japonica Intermediate	241	47.30%	51.90%	0.83%	0.00%	NA
VI/Aromatic	96	61.50%	38.50%	0.00%	0.00%	NA
Intermediate	90	65.60%	33.30%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1013543098	A -> C	LOC_Os10g26130.1	upstream_gene_variant ; 635.0bp to feature; MODIFIER	silent_mutation	Average:96.47; most accessible tissue: Zhenshan97 root, score: 98.962	N	N	N	N
vg1013543098	A -> C	LOC_Os10g26140.1	upstream_gene_variant ; 310.0bp to feature; MODIFIER	silent_mutation	Average:96.47; most accessible tissue: Zhenshan97 root, score: 98.962	N	N	N	N
vg1013543098	A -> C	LOC_Os10g26145.1	upstream_gene_variant ; 542.0bp to feature; MODIFIER	silent_mutation	Average:96.47; most accessible tissue: Zhenshan97 root, score: 98.962	N	N	N	N
vg1013543098	A -> C	LOC_Os10g26130.2	upstream_gene_variant ; 663.0bp to feature; MODIFIER	silent_mutation	Average:96.47; most accessible tissue: Zhenshan97 root, score: 98.962	N	N	N	N
vg1013543098	A -> C	LOC_Os10g26130.3	upstream_gene_variant ; 635.0bp to feature; MODIFIER	silent_mutation	Average:96.47; most accessible tissue: Zhenshan97 root, score: 98.962	N	N	N	N
vg1013543098	A -> C	LOC_Os10g26140.3	upstream_gene_variant ; 310.0bp to feature; MODIFIER	silent_mutation	Average:96.47; most accessible tissue: Zhenshan97 root, score: 98.962	N	N	N	N
vg1013543098	A -> C	LOC_Os10g26140.2	upstream_gene_variant ; 343.0bp to feature; MODIFIER	silent_mutation	Average:96.47; most accessible tissue: Zhenshan97 root, score: 98.962	N	N	N	N
vg1013543098	A -> C	LOC_Os10g26130-LOC_Os10g26140	intergenic_region ; MODIFIER	silent_mutation	Average:96.47; most accessible tissue: Zhenshan97 root, score: 98.962	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1013543098	A	C	0.0	0.0	-0.01	0.0	0.0	0.0

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1013543098	NA	8.79E-09	mr1005	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013543098	NA	6.15E-09	mr1275	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013543098	NA	3.15E-21	mr1300	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013543098	NA	9.08E-35	mr1310	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013543098	NA	9.92E-14	mr1410	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013543098	NA	4.10E-06	mr1424	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013543098	7.52E-14	3.17E-51	mr1533	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013543098	1.01E-11	2.49E-21	mr1533	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013543098	7.75E-13	6.87E-47	mr1980	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013543098	2.96E-09	1.51E-24	mr1980	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013543098	NA	1.35E-18	mr1156_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013543098	NA	5.56E-08	mr1156_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013543098	2.32E-19	4.01E-55	mr1533_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013543098	1.58E-15	4.06E-29	mr1533_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013543098	NA	1.25E-08	mr1660_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013543098	2.99E-11	7.74E-27	mr1980_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013543098	1.62E-06	1.60E-11	mr1980_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251