\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1013543098:

Variant ID: vg1013543098 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 13543098
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, A: 0.02, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:


CCGTAGAGCAAGTTTAATAGTATAGCCAAATCCTACCTCCAAATCATCTATAGCTAATTCATTCAATAGTTACTTACTATACTATTAATATAATATGGTC[A/C]
TATCTATCATACACACATTACATTTTGAAGTCCGTCCTGCAGCTGGCCTGCTGCTCTTCTCTTTTATCTTTTATCTCTTTAAAAATATGTTTATAGCTGG

Reverse complement sequence

CCAGCTATAAACATATTTTTAAAGAGATAAAAGATAAAAGAGAAGAGCAGCAGGCCAGCTGCAGGACGGACTTCAAAATGTAATGTGTGTATGATAGATA[T/G]
GACCATATTATATTAATAGTATAGTAAGTAACTATTGAATGAATTAGCTATAGATGATTTGGAGGTAGGATTTGGCTATACTATTAAACTTGCTCTACGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.20% 23.60% 0.17% 0.00% NA
All Indica  2759 98.50% 1.30% 0.18% 0.00% NA
All Japonica  1512 32.90% 66.90% 0.13% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 95.90% 3.40% 0.65% 0.00% NA
Indica III  913 99.70% 0.20% 0.11% 0.00% NA
Indica Intermediate  786 97.70% 2.20% 0.13% 0.00% NA
Temperate Japonica  767 5.60% 94.40% 0.00% 0.00% NA
Tropical Japonica  504 67.70% 32.30% 0.00% 0.00% NA
Japonica Intermediate  241 47.30% 51.90% 0.83% 0.00% NA
VI/Aromatic  96 61.50% 38.50% 0.00% 0.00% NA
Intermediate  90 65.60% 33.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1013543098 A -> C LOC_Os10g26130.1 upstream_gene_variant ; 635.0bp to feature; MODIFIER silent_mutation Average:96.47; most accessible tissue: Zhenshan97 root, score: 98.962 N N N N
vg1013543098 A -> C LOC_Os10g26140.1 upstream_gene_variant ; 310.0bp to feature; MODIFIER silent_mutation Average:96.47; most accessible tissue: Zhenshan97 root, score: 98.962 N N N N
vg1013543098 A -> C LOC_Os10g26145.1 upstream_gene_variant ; 542.0bp to feature; MODIFIER silent_mutation Average:96.47; most accessible tissue: Zhenshan97 root, score: 98.962 N N N N
vg1013543098 A -> C LOC_Os10g26130.2 upstream_gene_variant ; 663.0bp to feature; MODIFIER silent_mutation Average:96.47; most accessible tissue: Zhenshan97 root, score: 98.962 N N N N
vg1013543098 A -> C LOC_Os10g26130.3 upstream_gene_variant ; 635.0bp to feature; MODIFIER silent_mutation Average:96.47; most accessible tissue: Zhenshan97 root, score: 98.962 N N N N
vg1013543098 A -> C LOC_Os10g26140.3 upstream_gene_variant ; 310.0bp to feature; MODIFIER silent_mutation Average:96.47; most accessible tissue: Zhenshan97 root, score: 98.962 N N N N
vg1013543098 A -> C LOC_Os10g26140.2 upstream_gene_variant ; 343.0bp to feature; MODIFIER silent_mutation Average:96.47; most accessible tissue: Zhenshan97 root, score: 98.962 N N N N
vg1013543098 A -> C LOC_Os10g26130-LOC_Os10g26140 intergenic_region ; MODIFIER silent_mutation Average:96.47; most accessible tissue: Zhenshan97 root, score: 98.962 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1013543098 A C 0.0 0.0 -0.01 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1013543098 NA 8.79E-09 mr1005 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013543098 NA 6.15E-09 mr1275 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013543098 NA 3.15E-21 mr1300 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013543098 NA 9.08E-35 mr1310 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013543098 NA 9.92E-14 mr1410 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013543098 NA 4.10E-06 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013543098 7.52E-14 3.17E-51 mr1533 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013543098 1.01E-11 2.49E-21 mr1533 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013543098 7.75E-13 6.87E-47 mr1980 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013543098 2.96E-09 1.51E-24 mr1980 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013543098 NA 1.35E-18 mr1156_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013543098 NA 5.56E-08 mr1156_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013543098 2.32E-19 4.01E-55 mr1533_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013543098 1.58E-15 4.06E-29 mr1533_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013543098 NA 1.25E-08 mr1660_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013543098 2.99E-11 7.74E-27 mr1980_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013543098 1.62E-06 1.60E-11 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251