\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1013533412:

Variant ID: vg1013533412 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 13533412
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.05, others allele: 0.00, population size: 119. )

Flanking Sequence (100 bp) in Reference Genome:


CCCCTCCTGCGTGGATCCCGCCTTTTTGCCTCCCTTGCACATGGATCCGGCGATGGGAGGGGTGGATCCGGCGACTTCGAGCGATGACGATGATGACGGC[G/A]
GCCCAACAGCTTCGAGCGACGACGACGGCGGTAGATCTGACGCGACTACGGTGGCGTCTTCGGCTTGATGATGTCAGCAGTGAATCCGAGCATGATGGTG

Reverse complement sequence

CACCATCATGCTCGGATTCACTGCTGACATCATCAAGCCGAAGACGCCACCGTAGTCGCGTCAGATCTACCGCCGTCGTCGTCGCTCGAAGCTGTTGGGC[C/T]
GCCGTCATCATCGTCATCGCTCGAAGTCGCCGGATCCACCCCTCCCATCGCCGGATCCATGTGCAAGGGAGGCAAAAAGGCGGGATCCACGCAGGAGGGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.60% 43.40% 0.08% 0.00% NA
All Indica  2759 67.80% 32.10% 0.11% 0.00% NA
All Japonica  1512 31.60% 68.30% 0.07% 0.00% NA
Aus  269 98.50% 1.50% 0.00% 0.00% NA
Indica I  595 69.10% 30.90% 0.00% 0.00% NA
Indica II  465 85.20% 14.60% 0.22% 0.00% NA
Indica III  913 60.80% 39.00% 0.22% 0.00% NA
Indica Intermediate  786 64.80% 35.20% 0.00% 0.00% NA
Temperate Japonica  767 5.50% 94.50% 0.00% 0.00% NA
Tropical Japonica  504 64.50% 35.50% 0.00% 0.00% NA
Japonica Intermediate  241 46.10% 53.50% 0.41% 0.00% NA
VI/Aromatic  96 19.80% 80.20% 0.00% 0.00% NA
Intermediate  90 44.40% 55.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1013533412 G -> A LOC_Os10g26130.1 downstream_gene_variant ; 4133.0bp to feature; MODIFIER silent_mutation Average:57.4; most accessible tissue: Zhenshan97 young leaf, score: 84.624 N N N N
vg1013533412 G -> A LOC_Os10g26130.2 downstream_gene_variant ; 4133.0bp to feature; MODIFIER silent_mutation Average:57.4; most accessible tissue: Zhenshan97 young leaf, score: 84.624 N N N N
vg1013533412 G -> A LOC_Os10g26130.3 downstream_gene_variant ; 4133.0bp to feature; MODIFIER silent_mutation Average:57.4; most accessible tissue: Zhenshan97 young leaf, score: 84.624 N N N N
vg1013533412 G -> A LOC_Os10g26110-LOC_Os10g26130 intergenic_region ; MODIFIER silent_mutation Average:57.4; most accessible tissue: Zhenshan97 young leaf, score: 84.624 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1013533412 NA 3.19E-07 mr1022 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013533412 NA 5.24E-14 mr1301 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013533412 NA 7.67E-15 mr1410 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013533412 2.40E-41 2.69E-83 mr1533 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013533412 2.51E-25 1.75E-33 mr1533 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013533412 1.13E-12 5.80E-22 mr1533 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013533412 NA 8.50E-08 mr1667 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013533412 1.25E-46 5.32E-90 mr1980 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013533412 1.12E-29 7.23E-39 mr1980 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013533412 2.92E-11 2.61E-26 mr1980 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013533412 NA 9.09E-08 mr1156_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013533412 NA 1.29E-13 mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013533412 5.10E-43 1.33E-84 mr1533_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013533412 5.10E-30 1.55E-39 mr1533_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013533412 3.27E-14 1.49E-29 mr1533_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013533412 NA 1.25E-07 mr1952_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013533412 2.60E-20 9.10E-40 mr1980_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013533412 7.29E-12 1.86E-16 mr1980_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013533412 9.62E-07 3.96E-12 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251