Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1013533412:

Variant ID: vg1013533412 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 13533412
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.05, others allele: 0.00, population size: 119. )

Flanking Sequence (100 bp) in Reference Genome:

CCCCTCCTGCGTGGATCCCGCCTTTTTGCCTCCCTTGCACATGGATCCGGCGATGGGAGGGGTGGATCCGGCGACTTCGAGCGATGACGATGATGACGGC[G/A]
GCCCAACAGCTTCGAGCGACGACGACGGCGGTAGATCTGACGCGACTACGGTGGCGTCTTCGGCTTGATGATGTCAGCAGTGAATCCGAGCATGATGGTG

Reverse complement sequence

CACCATCATGCTCGGATTCACTGCTGACATCATCAAGCCGAAGACGCCACCGTAGTCGCGTCAGATCTACCGCCGTCGTCGTCGCTCGAAGCTGTTGGGC[C/T]
GCCGTCATCATCGTCATCGCTCGAAGTCGCCGGATCCACCCCTCCCATCGCCGGATCCATGTGCAAGGGAGGCAAAAAGGCGGGATCCACGCAGGAGGGG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.60%	43.40%	0.08%	0.00%	NA
All Indica	2759	67.80%	32.10%	0.11%	0.00%	NA
All Japonica	1512	31.60%	68.30%	0.07%	0.00%	NA
Aus	269	98.50%	1.50%	0.00%	0.00%	NA
Indica I	595	69.10%	30.90%	0.00%	0.00%	NA
Indica II	465	85.20%	14.60%	0.22%	0.00%	NA
Indica III	913	60.80%	39.00%	0.22%	0.00%	NA
Indica Intermediate	786	64.80%	35.20%	0.00%	0.00%	NA
Temperate Japonica	767	5.50%	94.50%	0.00%	0.00%	NA
Tropical Japonica	504	64.50%	35.50%	0.00%	0.00%	NA
Japonica Intermediate	241	46.10%	53.50%	0.41%	0.00%	NA
VI/Aromatic	96	19.80%	80.20%	0.00%	0.00%	NA
Intermediate	90	44.40%	55.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1013533412	G -> A	LOC_Os10g26130.1	downstream_gene_variant ; 4133.0bp to feature; MODIFIER	silent_mutation	Average:57.4; most accessible tissue: Zhenshan97 young leaf, score: 84.624	N	N	N	N
vg1013533412	G -> A	LOC_Os10g26130.2	downstream_gene_variant ; 4133.0bp to feature; MODIFIER	silent_mutation	Average:57.4; most accessible tissue: Zhenshan97 young leaf, score: 84.624	N	N	N	N
vg1013533412	G -> A	LOC_Os10g26130.3	downstream_gene_variant ; 4133.0bp to feature; MODIFIER	silent_mutation	Average:57.4; most accessible tissue: Zhenshan97 young leaf, score: 84.624	N	N	N	N
vg1013533412	G -> A	LOC_Os10g26110-LOC_Os10g26130	intergenic_region ; MODIFIER	silent_mutation	Average:57.4; most accessible tissue: Zhenshan97 young leaf, score: 84.624	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1013533412	NA	3.19E-07	mr1022	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013533412	NA	5.24E-14	mr1301	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013533412	NA	7.67E-15	mr1410	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013533412	2.40E-41	2.69E-83	mr1533	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013533412	2.51E-25	1.75E-33	mr1533	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013533412	1.13E-12	5.80E-22	mr1533	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013533412	NA	8.50E-08	mr1667	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013533412	1.25E-46	5.32E-90	mr1980	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013533412	1.12E-29	7.23E-39	mr1980	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013533412	2.92E-11	2.61E-26	mr1980	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013533412	NA	9.09E-08	mr1156_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013533412	NA	1.29E-13	mr1410_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013533412	5.10E-43	1.33E-84	mr1533_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013533412	5.10E-30	1.55E-39	mr1533_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013533412	3.27E-14	1.49E-29	mr1533_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013533412	NA	1.25E-07	mr1952_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013533412	2.60E-20	9.10E-40	mr1980_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013533412	7.29E-12	1.86E-16	mr1980_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013533412	9.62E-07	3.96E-12	mr1980_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251