\
| Variant ID: vg1013528269 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 13528269 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, A: 0.04, others allele: 0.00, population size: 117. )
TTCTACTAACTTATATAGTGTAGTATCATAAAATTTATATTTTGATTCACTTTTAGAAATACTTCTATAACATATAATTCACATGTTATTAAACTATATA[C/A]
CGATTTTTAAAATTTAATGACTAAAAGTAGATACATTTAATTTAAAATAAACCTAAAATAATTTGAAACCGATCGACAAAATACATGATTCAGTCCGAGA
TCTCGGACTGAATCATGTATTTTGTCGATCGGTTTCAAATTATTTTAGGTTTATTTTAAATTAAATGTATCTACTTTTAGTCATTAAATTTTAAAAATCG[G/T]
TATATAGTTTAATAACATGTGAATTATATGTTATAGAAGTATTTCTAAAAGTGAATCAAAATATAAATTTTATGATACTACACTATATAAGTTAGTAGAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.70% | 48.10% | 0.19% | 0.00% | NA |
| All Indica | 2759 | 31.90% | 67.70% | 0.33% | 0.00% | NA |
| All Japonica | 1512 | 94.20% | 5.80% | 0.00% | 0.00% | NA |
| Aus | 269 | 1.90% | 98.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 30.60% | 68.70% | 0.67% | 0.00% | NA |
| Indica II | 465 | 14.20% | 85.40% | 0.43% | 0.00% | NA |
| Indica III | 913 | 38.70% | 61.10% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 35.60% | 64.20% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 84.70% | 15.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 96.30% | 3.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 80.20% | 19.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 63.30% | 36.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1013528269 | C -> A | LOC_Os10g26110.1 | upstream_gene_variant ; 2344.0bp to feature; MODIFIER | silent_mutation | Average:45.52; most accessible tissue: Minghui63 root, score: 77.832 | N | N | N | N |
| vg1013528269 | C -> A | LOC_Os10g26110-LOC_Os10g26130 | intergenic_region ; MODIFIER | silent_mutation | Average:45.52; most accessible tissue: Minghui63 root, score: 77.832 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1013528269 | NA | 3.87E-12 | mr1232 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013528269 | NA | 2.47E-06 | mr1461 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013528269 | 2.17E-30 | 6.01E-69 | mr1533 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013528269 | 4.62E-26 | 1.11E-34 | mr1533 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013528269 | NA | 4.20E-18 | mr1557 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013528269 | NA | 2.41E-06 | mr1622 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013528269 | NA | 8.96E-08 | mr1667 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013528269 | 2.27E-29 | 1.63E-65 | mr1980 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013528269 | 5.48E-31 | 8.52E-41 | mr1980 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013528269 | 7.58E-26 | 7.52E-60 | mr1533_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013528269 | 3.07E-32 | 6.95E-42 | mr1533_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013528269 | 3.21E-12 | 5.04E-27 | mr1980_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013528269 | 5.30E-12 | 1.16E-16 | mr1980_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |