\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1013528269:

Variant ID: vg1013528269 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 13528269
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, A: 0.04, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


TTCTACTAACTTATATAGTGTAGTATCATAAAATTTATATTTTGATTCACTTTTAGAAATACTTCTATAACATATAATTCACATGTTATTAAACTATATA[C/A]
CGATTTTTAAAATTTAATGACTAAAAGTAGATACATTTAATTTAAAATAAACCTAAAATAATTTGAAACCGATCGACAAAATACATGATTCAGTCCGAGA

Reverse complement sequence

TCTCGGACTGAATCATGTATTTTGTCGATCGGTTTCAAATTATTTTAGGTTTATTTTAAATTAAATGTATCTACTTTTAGTCATTAAATTTTAAAAATCG[G/T]
TATATAGTTTAATAACATGTGAATTATATGTTATAGAAGTATTTCTAAAAGTGAATCAAAATATAAATTTTATGATACTACACTATATAAGTTAGTAGAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.70% 48.10% 0.19% 0.00% NA
All Indica  2759 31.90% 67.70% 0.33% 0.00% NA
All Japonica  1512 94.20% 5.80% 0.00% 0.00% NA
Aus  269 1.90% 98.10% 0.00% 0.00% NA
Indica I  595 30.60% 68.70% 0.67% 0.00% NA
Indica II  465 14.20% 85.40% 0.43% 0.00% NA
Indica III  913 38.70% 61.10% 0.22% 0.00% NA
Indica Intermediate  786 35.60% 64.20% 0.13% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 84.70% 15.30% 0.00% 0.00% NA
Japonica Intermediate  241 96.30% 3.70% 0.00% 0.00% NA
VI/Aromatic  96 80.20% 19.80% 0.00% 0.00% NA
Intermediate  90 63.30% 36.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1013528269 C -> A LOC_Os10g26110.1 upstream_gene_variant ; 2344.0bp to feature; MODIFIER silent_mutation Average:45.52; most accessible tissue: Minghui63 root, score: 77.832 N N N N
vg1013528269 C -> A LOC_Os10g26110-LOC_Os10g26130 intergenic_region ; MODIFIER silent_mutation Average:45.52; most accessible tissue: Minghui63 root, score: 77.832 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1013528269 NA 3.87E-12 mr1232 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013528269 NA 2.47E-06 mr1461 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013528269 2.17E-30 6.01E-69 mr1533 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013528269 4.62E-26 1.11E-34 mr1533 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013528269 NA 4.20E-18 mr1557 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013528269 NA 2.41E-06 mr1622 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013528269 NA 8.96E-08 mr1667 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013528269 2.27E-29 1.63E-65 mr1980 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013528269 5.48E-31 8.52E-41 mr1980 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013528269 7.58E-26 7.52E-60 mr1533_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013528269 3.07E-32 6.95E-42 mr1533_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013528269 3.21E-12 5.04E-27 mr1980_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013528269 5.30E-12 1.16E-16 mr1980_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251