RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg1013528269:

Variant ID: vg1013528269 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 13528269
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, A: 0.04, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:

TTCTACTAACTTATATAGTGTAGTATCATAAAATTTATATTTTGATTCACTTTTAGAAATACTTCTATAACATATAATTCACATGTTATTAAACTATATA[C/A]
CGATTTTTAAAATTTAATGACTAAAAGTAGATACATTTAATTTAAAATAAACCTAAAATAATTTGAAACCGATCGACAAAATACATGATTCAGTCCGAGA

Reverse complement sequence

TCTCGGACTGAATCATGTATTTTGTCGATCGGTTTCAAATTATTTTAGGTTTATTTTAAATTAAATGTATCTACTTTTAGTCATTAAATTTTAAAAATCG[G/T]
TATATAGTTTAATAACATGTGAATTATATGTTATAGAAGTATTTCTAAAAGTGAATCAAAATATAAATTTTATGATACTACACTATATAAGTTAGTAGAA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	51.70%	48.10%	0.19%	0.00%	NA
All Indica	2759	31.90%	67.70%	0.33%	0.00%	NA
All Japonica	1512	94.20%	5.80%	0.00%	0.00%	NA
Aus	269	1.90%	98.10%	0.00%	0.00%	NA
Indica I	595	30.60%	68.70%	0.67%	0.00%	NA
Indica II	465	14.20%	85.40%	0.43%	0.00%	NA
Indica III	913	38.70%	61.10%	0.22%	0.00%	NA
Indica Intermediate	786	35.60%	64.20%	0.13%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	84.70%	15.30%	0.00%	0.00%	NA
Japonica Intermediate	241	96.30%	3.70%	0.00%	0.00%	NA
VI/Aromatic	96	80.20%	19.80%	0.00%	0.00%	NA
Intermediate	90	63.30%	36.70%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1013528269	C -> A	LOC_Os10g26110.1	upstream_gene_variant ; 2344.0bp to feature; MODIFIER	silent_mutation	Average:45.52; most accessible tissue: Minghui63 root, score: 77.832	N	N	N	N
vg1013528269	C -> A	LOC_Os10g26110-LOC_Os10g26130	intergenic_region ; MODIFIER	silent_mutation	Average:45.52; most accessible tissue: Minghui63 root, score: 77.832	N	N	N	N

Showing 1 to 2 of 2 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1013528269	NA	3.87E-12	mr1232	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013528269	NA	2.47E-06	mr1461	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013528269	2.17E-30	6.01E-69	mr1533	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013528269	4.62E-26	1.11E-34	mr1533	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013528269	NA	4.20E-18	mr1557	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013528269	NA	2.41E-06	mr1622	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013528269	NA	8.96E-08	mr1667	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013528269	2.27E-29	1.63E-65	mr1980	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013528269	5.48E-31	8.52E-41	mr1980	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013528269	7.58E-26	7.52E-60	mr1533_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 13 entries

Previous1 2Next

Search for Variation information by Variation ID:

Detailed information for vg1013528269:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact