\
| Variant ID: vg1013528182 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 13528182 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.01, others allele: 0.00, population size: 117. )
GTTGAGACGTACGTGTCCAGCGTTTACATTACTTTAATTTTCCTAAGTTTGTCCTAAGTCTCAAACACTTTAATATTTGACTATTAATTCTACTAACTTA[T/C]
ATAGTGTAGTATCATAAAATTTATATTTTGATTCACTTTTAGAAATACTTCTATAACATATAATTCACATGTTATTAAACTATATACCGATTTTTAAAAT
ATTTTAAAAATCGGTATATAGTTTAATAACATGTGAATTATATGTTATAGAAGTATTTCTAAAAGTGAATCAAAATATAAATTTTATGATACTACACTAT[A/G]
TAAGTTAGTAGAATTAATAGTCAAATATTAAAGTGTTTGAGACTTAGGACAAACTTAGGAAAATTAAAGTAATGTAAACGCTGGACACGTACGTCTCAAC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 81.90% | 17.80% | 0.08% | 0.23% | NA |
| All Indica | 2759 | 69.90% | 29.50% | 0.14% | 0.40% | NA |
| All Japonica | 1512 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Aus | 269 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 69.10% | 30.10% | 0.34% | 0.50% | NA |
| Indica II | 465 | 88.60% | 11.00% | 0.00% | 0.43% | NA |
| Indica III | 913 | 63.50% | 35.90% | 0.11% | 0.44% | NA |
| Indica Intermediate | 786 | 66.90% | 32.70% | 0.13% | 0.25% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 87.80% | 12.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1013528182 | T -> C | LOC_Os10g26110.1 | upstream_gene_variant ; 2257.0bp to feature; MODIFIER | silent_mutation | Average:51.898; most accessible tissue: Minghui63 root, score: 79.298 | N | N | N | N |
| vg1013528182 | T -> C | LOC_Os10g26110-LOC_Os10g26130 | intergenic_region ; MODIFIER | silent_mutation | Average:51.898; most accessible tissue: Minghui63 root, score: 79.298 | N | N | N | N |
| vg1013528182 | T -> DEL | N | N | silent_mutation | Average:51.898; most accessible tissue: Minghui63 root, score: 79.298 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1013528182 | 7.37E-24 | NA | mr1533 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013528182 | 6.12E-25 | 4.65E-33 | mr1533 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013528182 | NA | 6.23E-07 | mr1667 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013528182 | 5.81E-28 | NA | mr1980 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013528182 | 3.37E-30 | 1.08E-38 | mr1980 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013528182 | 4.45E-23 | NA | mr1533_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013528182 | 3.96E-26 | 8.03E-35 | mr1533_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013528182 | 2.44E-09 | NA | mr1980_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013528182 | 9.46E-10 | 7.80E-14 | mr1980_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |