\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1013528182:

Variant ID: vg1013528182 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 13528182
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.01, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


GTTGAGACGTACGTGTCCAGCGTTTACATTACTTTAATTTTCCTAAGTTTGTCCTAAGTCTCAAACACTTTAATATTTGACTATTAATTCTACTAACTTA[T/C]
ATAGTGTAGTATCATAAAATTTATATTTTGATTCACTTTTAGAAATACTTCTATAACATATAATTCACATGTTATTAAACTATATACCGATTTTTAAAAT

Reverse complement sequence

ATTTTAAAAATCGGTATATAGTTTAATAACATGTGAATTATATGTTATAGAAGTATTTCTAAAAGTGAATCAAAATATAAATTTTATGATACTACACTAT[A/G]
TAAGTTAGTAGAATTAATAGTCAAATATTAAAGTGTTTGAGACTTAGGACAAACTTAGGAAAATTAAAGTAATGTAAACGCTGGACACGTACGTCTCAAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.90% 17.80% 0.08% 0.23% NA
All Indica  2759 69.90% 29.50% 0.14% 0.40% NA
All Japonica  1512 99.40% 0.60% 0.00% 0.00% NA
Aus  269 98.50% 1.50% 0.00% 0.00% NA
Indica I  595 69.10% 30.10% 0.34% 0.50% NA
Indica II  465 88.60% 11.00% 0.00% 0.43% NA
Indica III  913 63.50% 35.90% 0.11% 0.44% NA
Indica Intermediate  786 66.90% 32.70% 0.13% 0.25% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 98.60% 1.40% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 87.80% 12.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1013528182 T -> C LOC_Os10g26110.1 upstream_gene_variant ; 2257.0bp to feature; MODIFIER silent_mutation Average:51.898; most accessible tissue: Minghui63 root, score: 79.298 N N N N
vg1013528182 T -> C LOC_Os10g26110-LOC_Os10g26130 intergenic_region ; MODIFIER silent_mutation Average:51.898; most accessible tissue: Minghui63 root, score: 79.298 N N N N
vg1013528182 T -> DEL N N silent_mutation Average:51.898; most accessible tissue: Minghui63 root, score: 79.298 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1013528182 7.37E-24 NA mr1533 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013528182 6.12E-25 4.65E-33 mr1533 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013528182 NA 6.23E-07 mr1667 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013528182 5.81E-28 NA mr1980 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013528182 3.37E-30 1.08E-38 mr1980 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013528182 4.45E-23 NA mr1533_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013528182 3.96E-26 8.03E-35 mr1533_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013528182 2.44E-09 NA mr1980_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013528182 9.46E-10 7.80E-14 mr1980_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251