Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1013528182:

Variant ID: vg1013528182 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 13528182
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.01, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:

GTTGAGACGTACGTGTCCAGCGTTTACATTACTTTAATTTTCCTAAGTTTGTCCTAAGTCTCAAACACTTTAATATTTGACTATTAATTCTACTAACTTA[T/C]
ATAGTGTAGTATCATAAAATTTATATTTTGATTCACTTTTAGAAATACTTCTATAACATATAATTCACATGTTATTAAACTATATACCGATTTTTAAAAT

Reverse complement sequence

ATTTTAAAAATCGGTATATAGTTTAATAACATGTGAATTATATGTTATAGAAGTATTTCTAAAAGTGAATCAAAATATAAATTTTATGATACTACACTAT[A/G]
TAAGTTAGTAGAATTAATAGTCAAATATTAAAGTGTTTGAGACTTAGGACAAACTTAGGAAAATTAAAGTAATGTAAACGCTGGACACGTACGTCTCAAC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	81.90%	17.80%	0.08%	0.23%	NA
All Indica	2759	69.90%	29.50%	0.14%	0.40%	NA
All Japonica	1512	99.40%	0.60%	0.00%	0.00%	NA
Aus	269	98.50%	1.50%	0.00%	0.00%	NA
Indica I	595	69.10%	30.10%	0.34%	0.50%	NA
Indica II	465	88.60%	11.00%	0.00%	0.43%	NA
Indica III	913	63.50%	35.90%	0.11%	0.44%	NA
Indica Intermediate	786	66.90%	32.70%	0.13%	0.25%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	98.60%	1.40%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	87.80%	12.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1013528182	T -> C	LOC_Os10g26110.1	upstream_gene_variant ; 2257.0bp to feature; MODIFIER	silent_mutation	Average:51.898; most accessible tissue: Minghui63 root, score: 79.298	N	N	N	N
vg1013528182	T -> C	LOC_Os10g26110-LOC_Os10g26130	intergenic_region ; MODIFIER	silent_mutation	Average:51.898; most accessible tissue: Minghui63 root, score: 79.298	N	N	N	N
vg1013528182	T -> DEL	N	N	silent_mutation	Average:51.898; most accessible tissue: Minghui63 root, score: 79.298	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1013528182	7.37E-24	NA	mr1533	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013528182	6.12E-25	4.65E-33	mr1533	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013528182	NA	6.23E-07	mr1667	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013528182	5.81E-28	NA	mr1980	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013528182	3.37E-30	1.08E-38	mr1980	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013528182	4.45E-23	NA	mr1533_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013528182	3.96E-26	8.03E-35	mr1533_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013528182	2.44E-09	NA	mr1980_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013528182	9.46E-10	7.80E-14	mr1980_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251