\
| Variant ID: vg1013527440 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 13527440 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.00, others allele: 0.00, population size: 277. )
TAATACTATTGTTTGCTAACAATGATTCAAGTTGGAGATAGCTTGGTCTCGGAATATGGTTTCTTTGTTTATTTCATGTGTAGGTGACTTGATGCCTCGG[G/A]
AGAGTATTTGCGGTGATGGACCGGGAGTCGGCTTGGGGATAAGAGACGACGTCCATGGTAGTCAGAGATCATGCGGGATACTAAGGCTAGAGTTCAATAC
GTATTGAACTCTAGCCTTAGTATCCCGCATGATCTCTGACTACCATGGACGTCGTCTCTTATCCCCAAGCCGACTCCCGGTCCATCACCGCAAATACTCT[C/T]
CCGAGGCATCAAGTCACCTACACATGAAATAAACAAAGAAACCATATTCCGAGACCAAGCTATCTCCAACTTGAATCATTGTTAGCAAACAATAGTATTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.00% | 17.50% | 0.15% | 0.40% | NA |
| All Indica | 2759 | 69.90% | 29.10% | 0.25% | 0.69% | NA |
| All Japonica | 1512 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 69.10% | 29.90% | 0.34% | 0.67% | NA |
| Indica II | 465 | 88.60% | 11.00% | 0.00% | 0.43% | NA |
| Indica III | 913 | 63.50% | 35.30% | 0.33% | 0.88% | NA |
| Indica Intermediate | 786 | 66.90% | 32.20% | 0.25% | 0.64% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 87.80% | 12.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1013527440 | G -> A | LOC_Os10g26110.1 | upstream_gene_variant ; 1515.0bp to feature; MODIFIER | silent_mutation | Average:61.893; most accessible tissue: Minghui63 panicle, score: 77.956 | N | N | N | N |
| vg1013527440 | G -> A | LOC_Os10g26110-LOC_Os10g26130 | intergenic_region ; MODIFIER | silent_mutation | Average:61.893; most accessible tissue: Minghui63 panicle, score: 77.956 | N | N | N | N |
| vg1013527440 | G -> DEL | N | N | silent_mutation | Average:61.893; most accessible tissue: Minghui63 panicle, score: 77.956 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1013527440 | 1.53E-09 | NA | mr1533 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013527440 | 1.31E-09 | 2.58E-15 | mr1533 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013527440 | 4.56E-14 | NA | mr1980 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013527440 | 1.02E-14 | 4.84E-20 | mr1980 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013527440 | 1.48E-12 | NA | mr1533_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013527440 | 8.16E-14 | 5.63E-21 | mr1533_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013527440 | 2.74E-06 | NA | mr1980_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013527440 | 4.48E-06 | 3.36E-09 | mr1980_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |