\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1013524745:

Variant ID: vg1013524745 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 13524745
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.96, T: 0.03, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


GGAGAACCTCCTCTTCGCCACCACCTCGAACCGCTCGTCGGCGCTCACCGCGCGCTCGAACCACTCGGCCATGGCGACGTGGCGCCGGATGTGCGCGCGC[A/T]
TGCCCGCAGCGCCGTACCGCCGCAGCACGAACCAGAGCTTCATGGCGCGGAACCGCCGCGACAGCGAGATCTGCCAGTCCTTGTAGTCGATGGCGCCGGC

Reverse complement sequence

GCCGGCGCCATCGACTACAAGGACTGGCAGATCTCGCTGTCGCGGCGGTTCCGCGCCATGAAGCTCTGGTTCGTGCTGCGGCGGTACGGCGCTGCGGGCA[T/A]
GCGCGCGCACATCCGGCGCCACGTCGCCATGGCCGAGTGGTTCGAGCGCGCGGTGAGCGCCGACGAGCGGTTCGAGGTGGTGGCGAAGAGGAGGTTCTCC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.00% 39.80% 0.17% 0.00% NA
All Indica  2759 33.50% 66.20% 0.29% 0.00% NA
All Japonica  1512 99.30% 0.70% 0.00% 0.00% NA
Aus  269 92.20% 7.80% 0.00% 0.00% NA
Indica I  595 30.80% 68.90% 0.34% 0.00% NA
Indica II  465 15.70% 83.90% 0.43% 0.00% NA
Indica III  913 40.50% 59.30% 0.22% 0.00% NA
Indica Intermediate  786 37.90% 61.80% 0.25% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.00% 1.00% 0.00% 0.00% NA
Japonica Intermediate  241 97.90% 2.10% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 75.60% 24.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1013524745 A -> T LOC_Os10g26110.1 missense_variant ; p.Met394Lys; MODERATE nonsynonymous_codon ; M394K Average:81.867; most accessible tissue: Minghui63 panicle, score: 88.595 benign 1.383 DELETERIOUS 0.00

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1013524745 A T -0.01 -0.01 -0.02 0.0 -0.01 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1013524745 NA 4.80E-06 mr1312 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013524745 3.30E-24 9.37E-43 mr1533 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013524745 4.57E-25 8.75E-34 mr1533 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013524745 NA 1.74E-07 mr1667 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013524745 1.30E-27 5.32E-43 mr1980 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013524745 2.80E-30 5.09E-40 mr1980 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013524745 1.16E-26 1.26E-46 mr1533_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013524745 4.10E-32 5.51E-42 mr1533_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013524745 6.30E-11 5.14E-20 mr1980_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013524745 3.97E-11 7.97E-16 mr1980_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251