\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1013500622:

Variant ID: vg1013500622 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 13500622
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.00, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:


ATGATTTTTTAAAAGCAACTTTCCTATACATTTTTTTTTGGCAAAAAACACAGAGTTTAACAGTTTGGGAAGCGTGCTCATGGAAATCAAGAGAGTAAAC[G/A]
AATGCAGCCTAAATATCATTGCAACACTATTGCTCATGATTGTTACTTAAAGGTAGCAGTGTAAGTCCAAAAAGTCTACATTATCCTGTATCTACAATTA

Reverse complement sequence

TAATTGTAGATACAGGATAATGTAGACTTTTTGGACTTACACTGCTACCTTTAAGTAACAATCATGAGCAATAGTGTTGCAATGATATTTAGGCTGCATT[C/T]
GTTTACTCTCTTGATTTCCATGAGCACGCTTCCCAAACTGTTAAACTCTGTGTTTTTTGCCAAAAAAAAATGTATAGGAAAGTTGCTTTTAAAAAATCAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.30% 8.90% 4.80% 0.00% NA
All Indica  2759 76.90% 15.10% 8.01% 0.00% NA
All Japonica  1512 99.80% 0.10% 0.13% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 43.70% 33.80% 22.52% 0.00% NA
Indica II  465 85.60% 8.40% 6.02% 0.00% NA
Indica III  913 90.50% 8.90% 0.66% 0.00% NA
Indica Intermediate  786 81.00% 12.20% 6.74% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.00% 0.20% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 94.40% 1.10% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1013500622 G -> A LOC_Os10g26060.1 upstream_gene_variant ; 1187.0bp to feature; MODIFIER silent_mutation Average:39.931; most accessible tissue: Minghui63 flag leaf, score: 52.137 N N N N
vg1013500622 G -> A LOC_Os10g26050.1 downstream_gene_variant ; 3850.0bp to feature; MODIFIER silent_mutation Average:39.931; most accessible tissue: Minghui63 flag leaf, score: 52.137 N N N N
vg1013500622 G -> A LOC_Os10g26070.1 downstream_gene_variant ; 1229.0bp to feature; MODIFIER silent_mutation Average:39.931; most accessible tissue: Minghui63 flag leaf, score: 52.137 N N N N
vg1013500622 G -> A LOC_Os10g26050.2 downstream_gene_variant ; 3850.0bp to feature; MODIFIER silent_mutation Average:39.931; most accessible tissue: Minghui63 flag leaf, score: 52.137 N N N N
vg1013500622 G -> A LOC_Os10g26050.3 downstream_gene_variant ; 3850.0bp to feature; MODIFIER silent_mutation Average:39.931; most accessible tissue: Minghui63 flag leaf, score: 52.137 N N N N
vg1013500622 G -> A LOC_Os10g26050.4 downstream_gene_variant ; 3850.0bp to feature; MODIFIER silent_mutation Average:39.931; most accessible tissue: Minghui63 flag leaf, score: 52.137 N N N N
vg1013500622 G -> A LOC_Os10g26060-LOC_Os10g26070 intergenic_region ; MODIFIER silent_mutation Average:39.931; most accessible tissue: Minghui63 flag leaf, score: 52.137 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1013500622 2.06E-06 NA mr1533 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013500622 8.06E-07 NA mr1533 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013500622 4.93E-08 NA mr1980 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013500622 5.15E-08 NA mr1980 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013500622 NA 2.02E-06 mr1496_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013500622 1.53E-06 NA mr1533_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013500622 1.13E-06 4.08E-06 mr1533_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251