\
| Variant ID: vg1013500622 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 13500622 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.00, others allele: 0.00, population size: 295. )
ATGATTTTTTAAAAGCAACTTTCCTATACATTTTTTTTTGGCAAAAAACACAGAGTTTAACAGTTTGGGAAGCGTGCTCATGGAAATCAAGAGAGTAAAC[G/A]
AATGCAGCCTAAATATCATTGCAACACTATTGCTCATGATTGTTACTTAAAGGTAGCAGTGTAAGTCCAAAAAGTCTACATTATCCTGTATCTACAATTA
TAATTGTAGATACAGGATAATGTAGACTTTTTGGACTTACACTGCTACCTTTAAGTAACAATCATGAGCAATAGTGTTGCAATGATATTTAGGCTGCATT[C/T]
GTTTACTCTCTTGATTTCCATGAGCACGCTTCCCAAACTGTTAAACTCTGTGTTTTTTGCCAAAAAAAAATGTATAGGAAAGTTGCTTTTAAAAAATCAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.30% | 8.90% | 4.80% | 0.00% | NA |
| All Indica | 2759 | 76.90% | 15.10% | 8.01% | 0.00% | NA |
| All Japonica | 1512 | 99.80% | 0.10% | 0.13% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 43.70% | 33.80% | 22.52% | 0.00% | NA |
| Indica II | 465 | 85.60% | 8.40% | 6.02% | 0.00% | NA |
| Indica III | 913 | 90.50% | 8.90% | 0.66% | 0.00% | NA |
| Indica Intermediate | 786 | 81.00% | 12.20% | 6.74% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 1.10% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1013500622 | G -> A | LOC_Os10g26060.1 | upstream_gene_variant ; 1187.0bp to feature; MODIFIER | silent_mutation | Average:39.931; most accessible tissue: Minghui63 flag leaf, score: 52.137 | N | N | N | N |
| vg1013500622 | G -> A | LOC_Os10g26050.1 | downstream_gene_variant ; 3850.0bp to feature; MODIFIER | silent_mutation | Average:39.931; most accessible tissue: Minghui63 flag leaf, score: 52.137 | N | N | N | N |
| vg1013500622 | G -> A | LOC_Os10g26070.1 | downstream_gene_variant ; 1229.0bp to feature; MODIFIER | silent_mutation | Average:39.931; most accessible tissue: Minghui63 flag leaf, score: 52.137 | N | N | N | N |
| vg1013500622 | G -> A | LOC_Os10g26050.2 | downstream_gene_variant ; 3850.0bp to feature; MODIFIER | silent_mutation | Average:39.931; most accessible tissue: Minghui63 flag leaf, score: 52.137 | N | N | N | N |
| vg1013500622 | G -> A | LOC_Os10g26050.3 | downstream_gene_variant ; 3850.0bp to feature; MODIFIER | silent_mutation | Average:39.931; most accessible tissue: Minghui63 flag leaf, score: 52.137 | N | N | N | N |
| vg1013500622 | G -> A | LOC_Os10g26050.4 | downstream_gene_variant ; 3850.0bp to feature; MODIFIER | silent_mutation | Average:39.931; most accessible tissue: Minghui63 flag leaf, score: 52.137 | N | N | N | N |
| vg1013500622 | G -> A | LOC_Os10g26060-LOC_Os10g26070 | intergenic_region ; MODIFIER | silent_mutation | Average:39.931; most accessible tissue: Minghui63 flag leaf, score: 52.137 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1013500622 | 2.06E-06 | NA | mr1533 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013500622 | 8.06E-07 | NA | mr1533 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013500622 | 4.93E-08 | NA | mr1980 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013500622 | 5.15E-08 | NA | mr1980 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013500622 | NA | 2.02E-06 | mr1496_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013500622 | 1.53E-06 | NA | mr1533_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013500622 | 1.13E-06 | 4.08E-06 | mr1533_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |