Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1013500622:

Variant ID: vg1013500622 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 13500622
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.00, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:

ATGATTTTTTAAAAGCAACTTTCCTATACATTTTTTTTTGGCAAAAAACACAGAGTTTAACAGTTTGGGAAGCGTGCTCATGGAAATCAAGAGAGTAAAC[G/A]
AATGCAGCCTAAATATCATTGCAACACTATTGCTCATGATTGTTACTTAAAGGTAGCAGTGTAAGTCCAAAAAGTCTACATTATCCTGTATCTACAATTA

Reverse complement sequence

TAATTGTAGATACAGGATAATGTAGACTTTTTGGACTTACACTGCTACCTTTAAGTAACAATCATGAGCAATAGTGTTGCAATGATATTTAGGCTGCATT[C/T]
GTTTACTCTCTTGATTTCCATGAGCACGCTTCCCAAACTGTTAAACTCTGTGTTTTTTGCCAAAAAAAAATGTATAGGAAAGTTGCTTTTAAAAAATCAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.30%	8.90%	4.80%	0.00%	NA
All Indica	2759	76.90%	15.10%	8.01%	0.00%	NA
All Japonica	1512	99.80%	0.10%	0.13%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	43.70%	33.80%	22.52%	0.00%	NA
Indica II	465	85.60%	8.40%	6.02%	0.00%	NA
Indica III	913	90.50%	8.90%	0.66%	0.00%	NA
Indica Intermediate	786	81.00%	12.20%	6.74%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.00%	0.20%	0.00%	NA
Japonica Intermediate	241	99.60%	0.00%	0.41%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	94.40%	1.10%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1013500622	G -> A	LOC_Os10g26060.1	upstream_gene_variant ; 1187.0bp to feature; MODIFIER	silent_mutation	Average:39.931; most accessible tissue: Minghui63 flag leaf, score: 52.137	N	N	N	N
vg1013500622	G -> A	LOC_Os10g26050.1	downstream_gene_variant ; 3850.0bp to feature; MODIFIER	silent_mutation	Average:39.931; most accessible tissue: Minghui63 flag leaf, score: 52.137	N	N	N	N
vg1013500622	G -> A	LOC_Os10g26070.1	downstream_gene_variant ; 1229.0bp to feature; MODIFIER	silent_mutation	Average:39.931; most accessible tissue: Minghui63 flag leaf, score: 52.137	N	N	N	N
vg1013500622	G -> A	LOC_Os10g26050.2	downstream_gene_variant ; 3850.0bp to feature; MODIFIER	silent_mutation	Average:39.931; most accessible tissue: Minghui63 flag leaf, score: 52.137	N	N	N	N
vg1013500622	G -> A	LOC_Os10g26050.3	downstream_gene_variant ; 3850.0bp to feature; MODIFIER	silent_mutation	Average:39.931; most accessible tissue: Minghui63 flag leaf, score: 52.137	N	N	N	N
vg1013500622	G -> A	LOC_Os10g26050.4	downstream_gene_variant ; 3850.0bp to feature; MODIFIER	silent_mutation	Average:39.931; most accessible tissue: Minghui63 flag leaf, score: 52.137	N	N	N	N
vg1013500622	G -> A	LOC_Os10g26060-LOC_Os10g26070	intergenic_region ; MODIFIER	silent_mutation	Average:39.931; most accessible tissue: Minghui63 flag leaf, score: 52.137	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1013500622	2.06E-06	NA	mr1533	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013500622	8.06E-07	NA	mr1533	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013500622	4.93E-08	NA	mr1980	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013500622	5.15E-08	NA	mr1980	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013500622	NA	2.02E-06	mr1496_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013500622	1.53E-06	NA	mr1533_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013500622	1.13E-06	4.08E-06	mr1533_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251