\
| Variant ID: vg1013489724 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 13489724 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, T: 0.08, others allele: 0.00, population size: 104. )
TGATTGATATACCCAAAAACCGAAAACTTTTAGCGGAAATAGAAGTTACCCTCGAAATCGACGGAAGTCGGTCTGACCGAGATTAATCTGCCGGTCTGAC[C/T]
GAAGCGTAGCCGCCGGTCTGACCGGTGTTGATCTTCTGGTTGGACTGCCCTGGAATCCCTGCCGCGCCTATTGTCGCCGCCGGTCTGACCGCAGGTCACC
GGTGACCTGCGGTCAGACCGGCGGCGACAATAGGCGCGGCAGGGATTCCAGGGCAGTCCAACCAGAAGATCAACACCGGTCAGACCGGCGGCTACGCTTC[G/A]
GTCAGACCGGCAGATTAATCTCGGTCAGACCGACTTCCGTCGATTTCGAGGGTAACTTCTATTTCCGCTAAAAGTTTTCGGTTTTTGGGTATATCAATCA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 75.20% | 24.70% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 98.90% | 1.00% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 32.20% | 67.80% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.20% | 0.34% | 0.00% | NA |
| Indica II | 465 | 97.00% | 3.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.60% | 1.30% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 5.70% | 94.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 65.90% | 34.10% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 46.10% | 53.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 18.80% | 81.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 56.70% | 42.20% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1013489724 | C -> T | LOC_Os10g26040.1 | missense_variant ; p.Gly74Ser; MODERATE | nonsynonymous_codon ; G74S | Average:47.876; most accessible tissue: Minghui63 root, score: 68.289 | unknown | unknown | TOLERATED | 0.11 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1013489724 | NA | 5.69E-09 | mr1005 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013489724 | NA | 5.92E-09 | mr1275 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013489724 | NA | 1.28E-23 | mr1300 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013489724 | 1.84E-07 | NA | mr1301 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013489724 | NA | 8.15E-15 | mr1301 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013489724 | NA | 9.84E-36 | mr1310 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013489724 | NA | 2.08E-07 | mr1364 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013489724 | NA | 3.32E-14 | mr1410 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013489724 | NA | 2.16E-11 | mr1410 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013489724 | NA | 9.56E-08 | mr1424 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013489724 | NA | 5.90E-06 | mr1450 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013489724 | NA | 9.69E-06 | mr1461 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013489724 | 6.58E-16 | 1.00E-52 | mr1533 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013489724 | 5.06E-15 | 7.41E-24 | mr1533 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013489724 | NA | 1.87E-06 | mr1881 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013489724 | NA | 1.88E-06 | mr1884 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013489724 | 2.41E-17 | 7.05E-50 | mr1980 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013489724 | 1.64E-14 | 7.26E-30 | mr1980 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013489724 | 3.53E-12 | 1.84E-49 | mr1533_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013489724 | 2.40E-12 | 2.39E-27 | mr1533_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013489724 | 1.34E-07 | 2.29E-23 | mr1980_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013489724 | 3.58E-06 | 2.91E-11 | mr1980_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |