\
| Variant ID: vg1013488546 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 13488546 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CGCGCCATGAAGCAAACATCGGAGATGTTCTTTCCCTTATCATCATCTCCACTCTCACCATCTACATCACTTAGTGGCTCGAAGGCGGCGCAAACTTGTT[G/C]
AAAAGCCTTCCTGAGATTCTCCATCTTCCTCCCTTGGTATGAACCCTTCGGCTTGTTGTTGTTGTTCTTCTCACCATCTTTGTCTTCTCTTTTGCCTCTC
GAGAGGCAAAAGAGAAGACAAAGATGGTGAGAAGAACAACAACAACAAGCCGAAGGGTTCATACCAAGGGAGGAAGATGGAGAATCTCAGGAAGGCTTTT[C/G]
AACAAGTTTGCGCCGCCTTCGAGCCACTAAGTGATGTAGATGGTGAGAGTGGAGATGATGATAAGGGAAAGAACATCTCCGATGTTTGCTTCATGGCGCG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.50% | 8.50% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 74.30% | 25.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 94.70% | 5.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 51.40% | 48.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 57.30% | 42.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1013488546 | G -> C | LOC_Os10g26040.1 | missense_variant ; p.Gln197Glu; MODERATE | nonsynonymous_codon ; Q197E | Average:24.981; most accessible tissue: Minghui63 young leaf, score: 39.381 | benign |
0.958 |
TOLERATED | 0.23 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1013488546 | NA | 2.27E-07 | mr1248 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013488546 | 2.13E-06 | NA | mr1533 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013488546 | NA | 1.96E-13 | mr1533 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013488546 | NA | 6.04E-31 | mr1699 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013488546 | 1.13E-09 | NA | mr1980 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013488546 | 1.69E-06 | 1.86E-19 | mr1980 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013488546 | NA | 1.31E-06 | mr1422_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013488546 | 2.05E-15 | NA | mr1533_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013488546 | 1.98E-14 | 1.79E-28 | mr1533_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013488546 | NA | 5.65E-07 | mr1554_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013488546 | 4.93E-06 | 4.93E-06 | mr1610_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013488546 | NA | 6.28E-10 | mr1819_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013488546 | 1.09E-09 | NA | mr1980_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013488546 | 9.00E-07 | 1.27E-11 | mr1980_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |