Search for Variation information by Variation ID:
Detailed information for vg1013484683:
| Variant ID: vg1013484683 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 13484683 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.65, G: 0.35, others allele: 0.00, population size: 204. )
Flanking Sequence (100 bp) in Reference Genome:
GTAGAACCAATTGGTGTTGAAATTGGCTTGCAATTCTCCATCTTGAACCGTTCCAAAAGATCCTTCGTATACTTGGTTTGATGCACAAAAGTACCTTGAG[G/A]
TGTTTGCTTAATTTGCAATCCCAAAAAGTATGATAACTCACCCATCATGCTCATCTCAAATTCCCTGCGCATATTCTCAGCAAAATCTACAACCAAAGCG
Reverse complement sequence
CGCTTTGGTTGTAGATTTTGCTGAGAATATGCGCAGGGAATTTGAGATGAGCATGATGGGTGAGTTATCATACTTTTTGGGATTGCAAATTAAGCAAACA[C/T]
CTCAAGGTACTTTTGTGCATCAAACCAAGTATACGAAGGATCTTTTGGAACGGTTCAAGATGGAGAATTGCAAGCCAATTTCAACACCAATTGGTTCTAC
Allele Frequencies:
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 75.10% | 24.80% | 0.17% | 0.00% | NA |
| All Indica | 2759 | 98.70% | 1.10% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 32.20% | 67.80% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.00% | 0.50% | 0.00% | NA |
| Indica II | 465 | 96.60% | 3.20% | 0.22% | 0.00% | NA |
| Indica III | 913 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.20% | 1.70% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 5.70% | 94.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 65.70% | 34.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 46.50% | 53.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 19.80% | 80.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 55.60% | 41.10% | 3.33% | 0.00% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1013484683 | G -> A | LOC_Os10g26040.1 | missense_variant ; p.Pro1040Ser; MODERATE | nonsynonymous_codon ; P1040S | Average:15.899; most accessible tissue: Minghui63 young leaf, score: 23.613 | benign  |
0.363 |
TOLERATED | 0.26 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1013484683 | NA | 1.53E-15 | mr1301 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013484683 | NA | 9.19E-12 | mr1410 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013484683 | NA | 4.74E-06 | mr1424 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013484683 | 1.91E-10 | 4.88E-19 | mr1533 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013484683 | 4.47E-08 | 1.63E-21 | mr1980 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013484683 | NA | 1.83E-12 | mr1410_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013484683 | 4.73E-15 | 7.93E-31 | mr1533_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013484683 | NA | 1.45E-07 | mr1578_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013484683 | NA | 2.18E-18 | mr1980_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013484683 | 3.02E-07 | 1.33E-12 | mr1980_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |