\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1013482552:

Variant ID: vg1013482552 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 13482552
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACTCATTAGTAGCAAACAACAGTATTACATACGTATAGTATTCATCTAGAAGTCATAATCATGAAATAATCACGGATATCCAAACAAACAACCCGAAACC[G/A]
AAACCGACACAGTGTCGGTTTGTCAGACCGCGGGCTGGACGGTCCGACCGCTCGATCACCGCCAGTCTGACCGGCTACCAGAGCCCGGTCTGACCGGTCA

Reverse complement sequence

TGACCGGTCAGACCGGGCTCTGGTAGCCGGTCAGACTGGCGGTGATCGAGCGGTCGGACCGTCCAGCCCGCGGTCTGACAAACCGACACTGTGTCGGTTT[C/T]
GGTTTCGGGTTGTTTGTTTGGATATCCGTGATTATTTCATGATTATGACTTCTAGATGAATACTATACGTATGTAATACTGTTGTTTGCTACTAATGAGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.10% 14.80% 0.04% 0.00% NA
All Indica  2759 98.50% 1.50% 0.00% 0.00% NA
All Japonica  1512 74.20% 25.80% 0.00% 0.00% NA
Aus  269 11.50% 87.70% 0.74% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 98.90% 1.10% 0.00% 0.00% NA
Indica III  913 98.40% 1.60% 0.00% 0.00% NA
Indica Intermediate  786 97.30% 2.70% 0.00% 0.00% NA
Temperate Japonica  767 94.80% 5.20% 0.00% 0.00% NA
Tropical Japonica  504 51.20% 48.80% 0.00% 0.00% NA
Japonica Intermediate  241 56.80% 43.20% 0.00% 0.00% NA
VI/Aromatic  96 81.20% 18.80% 0.00% 0.00% NA
Intermediate  90 82.20% 17.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1013482552 G -> A LOC_Os10g26030.1 downstream_gene_variant ; 4569.0bp to feature; MODIFIER silent_mutation Average:30.752; most accessible tissue: Zhenshan97 flag leaf, score: 50.663 N N N N
vg1013482552 G -> A LOC_Os10g26040.1 downstream_gene_variant ; 1580.0bp to feature; MODIFIER silent_mutation Average:30.752; most accessible tissue: Zhenshan97 flag leaf, score: 50.663 N N N N
vg1013482552 G -> A LOC_Os10g26030-LOC_Os10g26040 intergenic_region ; MODIFIER silent_mutation Average:30.752; most accessible tissue: Zhenshan97 flag leaf, score: 50.663 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1013482552 NA 2.60E-11 mr1533 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013482552 NA 2.37E-10 mr1610 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013482552 NA 8.26E-13 mr1980 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013482552 NA 1.58E-15 mr1533_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013482552 NA 4.43E-07 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251