\
| Variant ID: vg1013482552 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 13482552 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ACTCATTAGTAGCAAACAACAGTATTACATACGTATAGTATTCATCTAGAAGTCATAATCATGAAATAATCACGGATATCCAAACAAACAACCCGAAACC[G/A]
AAACCGACACAGTGTCGGTTTGTCAGACCGCGGGCTGGACGGTCCGACCGCTCGATCACCGCCAGTCTGACCGGCTACCAGAGCCCGGTCTGACCGGTCA
TGACCGGTCAGACCGGGCTCTGGTAGCCGGTCAGACTGGCGGTGATCGAGCGGTCGGACCGTCCAGCCCGCGGTCTGACAAACCGACACTGTGTCGGTTT[C/T]
GGTTTCGGGTTGTTTGTTTGGATATCCGTGATTATTTCATGATTATGACTTCTAGATGAATACTATACGTATGTAATACTGTTGTTTGCTACTAATGAGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.10% | 14.80% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 74.20% | 25.80% | 0.00% | 0.00% | NA |
| Aus | 269 | 11.50% | 87.70% | 0.74% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.40% | 1.60% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.30% | 2.70% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 51.20% | 48.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 56.80% | 43.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 81.20% | 18.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 17.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1013482552 | G -> A | LOC_Os10g26030.1 | downstream_gene_variant ; 4569.0bp to feature; MODIFIER | silent_mutation | Average:30.752; most accessible tissue: Zhenshan97 flag leaf, score: 50.663 | N | N | N | N |
| vg1013482552 | G -> A | LOC_Os10g26040.1 | downstream_gene_variant ; 1580.0bp to feature; MODIFIER | silent_mutation | Average:30.752; most accessible tissue: Zhenshan97 flag leaf, score: 50.663 | N | N | N | N |
| vg1013482552 | G -> A | LOC_Os10g26030-LOC_Os10g26040 | intergenic_region ; MODIFIER | silent_mutation | Average:30.752; most accessible tissue: Zhenshan97 flag leaf, score: 50.663 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1013482552 | NA | 2.60E-11 | mr1533 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013482552 | NA | 2.37E-10 | mr1610 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013482552 | NA | 8.26E-13 | mr1980 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013482552 | NA | 1.58E-15 | mr1533_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013482552 | NA | 4.43E-07 | mr1980_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |