\
| Variant ID: vg1013482483 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 13482483 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GGCATCGAGTCACCTACACATGAAATAAACAAAGAAACCATATTCCGAGACCAAGCTATCTCCAACTTGACTCATTAGTAGCAAACAACAGTATTACATA[C/T]
GTATAGTATTCATCTAGAAGTCATAATCATGAAATAATCACGGATATCCAAACAAACAACCCGAAACCGAAACCGACACAGTGTCGGTTTGTCAGACCGC
GCGGTCTGACAAACCGACACTGTGTCGGTTTCGGTTTCGGGTTGTTTGTTTGGATATCCGTGATTATTTCATGATTATGACTTCTAGATGAATACTATAC[G/A]
TATGTAATACTGTTGTTTGCTACTAATGAGTCAAGTTGGAGATAGCTTGGTCTCGGAATATGGTTTCTTTGTTTATTTCATGTGTAGGTGACTCGATGCC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.40% | 8.60% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 74.00% | 26.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 94.70% | 5.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 50.40% | 49.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 57.70% | 42.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1013482483 | C -> T | LOC_Os10g26030.1 | downstream_gene_variant ; 4500.0bp to feature; MODIFIER | silent_mutation | Average:33.756; most accessible tissue: Zhenshan97 flag leaf, score: 52.255 | N | N | N | N |
| vg1013482483 | C -> T | LOC_Os10g26040.1 | downstream_gene_variant ; 1649.0bp to feature; MODIFIER | silent_mutation | Average:33.756; most accessible tissue: Zhenshan97 flag leaf, score: 52.255 | N | N | N | N |
| vg1013482483 | C -> T | LOC_Os10g26030-LOC_Os10g26040 | intergenic_region ; MODIFIER | silent_mutation | Average:33.756; most accessible tissue: Zhenshan97 flag leaf, score: 52.255 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1013482483 | NA | 3.19E-06 | mr1248 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013482483 | 6.24E-07 | NA | mr1533 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013482483 | 3.33E-06 | 4.83E-14 | mr1533 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013482483 | NA | 5.77E-08 | mr1668 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013482483 | NA | 1.52E-11 | mr1871 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013482483 | 6.62E-09 | NA | mr1980 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013482483 | NA | 3.81E-20 | mr1980 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013482483 | 9.63E-17 | NA | mr1533_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013482483 | 2.49E-15 | 3.31E-28 | mr1533_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013482483 | NA | 1.23E-06 | mr1554_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013482483 | NA | 2.63E-08 | mr1819_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013482483 | 5.82E-08 | NA | mr1980_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013482483 | 9.82E-06 | 1.74E-10 | mr1980_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |