\
| Variant ID: vg1013475370 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 13475370 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.86, A: 0.14, others allele: 0.00, population size: 101. )
AGCTATTAGTGGACAAGGAGATGGCGTCAGGAGTGCCCACAGTCCACCACCCAAACCAGCTGTGTCAAGCATGTCTGGTGGCGAAACAAGTCCGGCAGCC[G/A]
TTCCCAGGAATGGCAAACTATCGAGCAGAGGCGCCGCTCGAGCTGCTCCACATGGATCTGTGTGGGCCGATCACTCCATCGACGTTCGCCGGTAATCGAT
ATCGATTACCGGCGAACGTCGATGGAGTGATCGGCCCACACAGATCCATGTGGAGCAGCTCGAGCGGCGCCTCTGCTCGATAGTTTGCCATTCCTGGGAA[C/T]
GGCTGCCGGACTTGTTTCGCCACCAGACATGCTTGACACAGCTGGTTTGGGTGGTGGACTGTGGGCACTCCTGACGCCATCTCCTTGTCCACTAATAGCT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 35.20% | 24.60% | 25.60% | 14.58% | NA |
| All Indica | 2759 | 39.40% | 1.00% | 40.01% | 19.57% | NA |
| All Japonica | 1512 | 28.50% | 67.70% | 2.65% | 1.19% | NA |
| Aus | 269 | 41.60% | 0.40% | 15.24% | 42.75% | NA |
| Indica I | 595 | 47.20% | 0.00% | 49.08% | 3.70% | NA |
| Indica II | 465 | 48.00% | 2.80% | 35.70% | 13.55% | NA |
| Indica III | 913 | 29.10% | 0.40% | 35.93% | 34.50% | NA |
| Indica Intermediate | 786 | 40.30% | 1.40% | 40.46% | 17.81% | NA |
| Temperate Japonica | 767 | 5.60% | 94.10% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 58.90% | 34.10% | 3.97% | 2.98% | NA |
| Japonica Intermediate | 241 | 37.80% | 53.50% | 7.47% | 1.24% | NA |
| VI/Aromatic | 96 | 9.40% | 79.20% | 4.17% | 7.29% | NA |
| Intermediate | 90 | 27.80% | 38.90% | 23.33% | 10.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1013475370 | G -> A | LOC_Os10g26030.1 | synonymous_variant ; p.Pro388Pro; LOW | synonymous_codon | Average:45.921; most accessible tissue: Minghui63 young leaf, score: 64.378 | N | N | N | N |
| vg1013475370 | G -> DEL | LOC_Os10g26030.1 | N | frameshift_variant | Average:45.921; most accessible tissue: Minghui63 young leaf, score: 64.378 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1013475370 | NA | 4.04E-07 | mr1022 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013475370 | 5.83E-06 | 2.16E-08 | mr1424 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013475370 | NA | 9.40E-06 | mr1450 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013475370 | NA | 9.25E-06 | mr1511 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013475370 | 2.02E-11 | 7.57E-48 | mr1533 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013475370 | 9.26E-13 | 3.92E-22 | mr1533 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013475370 | NA | 2.19E-06 | mr1881 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013475370 | NA | 5.62E-08 | mr1884 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013475370 | 2.38E-09 | 3.02E-43 | mr1980 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013475370 | 6.13E-10 | 2.99E-25 | mr1980 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013475370 | NA | 9.24E-08 | mr1156_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013475370 | 4.06E-11 | 3.67E-47 | mr1533_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013475370 | 2.82E-11 | 2.34E-26 | mr1533_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013475370 | 7.25E-09 | 5.26E-25 | mr1980_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013475370 | 6.05E-06 | 2.97E-11 | mr1980_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |