\
| Variant ID: vg1013444607 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 13444607 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.71, A: 0.30, others allele: 0.00, population size: 82. )
ATCTGTTTGCGGAATAAGAATATAGCCTAAGGTCTTCCTCGAACCTGGTCTAGTCCTGGGTCTCGGTCTCACCTTAGCTCATCTAGGTTACAATACTGCT[C/A]
TGTGAAGAGAAGTGATGAGACCTATAAAAGCTATGTTTTATAAGAATGTAACACAAGGTTTGCCTCGAATCCGGCCTCGTCATGGGACCCGAGTTCGCAT
ATGCGAACTCGGGTCCCATGACGAGGCCGGATTCGAGGCAAACCTTGTGTTACATTCTTATAAAACATAGCTTTTATAGGTCTCATCACTTCTCTTCACA[G/T]
AGCAGTATTGTAACCTAGATGAGCTAAGGTGAGACCGAGACCCAGGACTAGACCAGGTTCGAGGAAGACCTTAGGCTATATTCTTATTCCGCAAACAGAT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 77.40% | 21.70% | 0.97% | 0.00% | NA |
| All Indica | 2759 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 38.50% | 58.50% | 3.04% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.20% | 2.80% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 16.80% | 77.70% | 5.48% | 0.00% | NA |
| Tropical Japonica | 504 | 66.10% | 33.70% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 49.80% | 49.00% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 20.80% | 79.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 57.80% | 42.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1013444607 | C -> A | LOC_Os10g25930.1 | downstream_gene_variant ; 4969.0bp to feature; MODIFIER | silent_mutation | Average:59.396; most accessible tissue: Zhenshan97 root, score: 69.506 | N | N | N | N |
| vg1013444607 | C -> A | LOC_Os10g25940.1 | downstream_gene_variant ; 420.0bp to feature; MODIFIER | silent_mutation | Average:59.396; most accessible tissue: Zhenshan97 root, score: 69.506 | N | N | N | N |
| vg1013444607 | C -> A | LOC_Os10g25950.1 | downstream_gene_variant ; 4615.0bp to feature; MODIFIER | silent_mutation | Average:59.396; most accessible tissue: Zhenshan97 root, score: 69.506 | N | N | N | N |
| vg1013444607 | C -> A | LOC_Os10g25940-LOC_Os10g25950 | intergenic_region ; MODIFIER | silent_mutation | Average:59.396; most accessible tissue: Zhenshan97 root, score: 69.506 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1013444607 | 1.27E-07 | 5.37E-17 | mr1324 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013444607 | NA | 1.38E-10 | mr1325 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013444607 | 7.72E-07 | 1.58E-14 | mr1335 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013444607 | NA | 8.34E-07 | mr1424 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013444607 | NA | 4.88E-06 | mr1511 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013444607 | 1.15E-06 | 2.75E-36 | mr1533 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013444607 | NA | 3.10E-09 | mr1533 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013444607 | 2.78E-06 | 1.70E-35 | mr1980 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013444607 | NA | 1.55E-11 | mr1980 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |