\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1013444607:

Variant ID: vg1013444607 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 13444607
Reference Allele: CAlternative Allele: A
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.71, A: 0.30, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


ATCTGTTTGCGGAATAAGAATATAGCCTAAGGTCTTCCTCGAACCTGGTCTAGTCCTGGGTCTCGGTCTCACCTTAGCTCATCTAGGTTACAATACTGCT[C/A]
TGTGAAGAGAAGTGATGAGACCTATAAAAGCTATGTTTTATAAGAATGTAACACAAGGTTTGCCTCGAATCCGGCCTCGTCATGGGACCCGAGTTCGCAT

Reverse complement sequence

ATGCGAACTCGGGTCCCATGACGAGGCCGGATTCGAGGCAAACCTTGTGTTACATTCTTATAAAACATAGCTTTTATAGGTCTCATCACTTCTCTTCACA[G/T]
AGCAGTATTGTAACCTAGATGAGCTAAGGTGAGACCGAGACCCAGGACTAGACCAGGTTCGAGGAAGACCTTAGGCTATATTCTTATTCCGCAAACAGAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.40% 21.70% 0.97% 0.00% NA
All Indica  2759 99.10% 0.90% 0.00% 0.00% NA
All Japonica  1512 38.50% 58.50% 3.04% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 97.20% 2.80% 0.00% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 98.70% 1.30% 0.00% 0.00% NA
Temperate Japonica  767 16.80% 77.70% 5.48% 0.00% NA
Tropical Japonica  504 66.10% 33.70% 0.20% 0.00% NA
Japonica Intermediate  241 49.80% 49.00% 1.24% 0.00% NA
VI/Aromatic  96 20.80% 79.20% 0.00% 0.00% NA
Intermediate  90 57.80% 42.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1013444607 C -> A LOC_Os10g25930.1 downstream_gene_variant ; 4969.0bp to feature; MODIFIER silent_mutation Average:59.396; most accessible tissue: Zhenshan97 root, score: 69.506 N N N N
vg1013444607 C -> A LOC_Os10g25940.1 downstream_gene_variant ; 420.0bp to feature; MODIFIER silent_mutation Average:59.396; most accessible tissue: Zhenshan97 root, score: 69.506 N N N N
vg1013444607 C -> A LOC_Os10g25950.1 downstream_gene_variant ; 4615.0bp to feature; MODIFIER silent_mutation Average:59.396; most accessible tissue: Zhenshan97 root, score: 69.506 N N N N
vg1013444607 C -> A LOC_Os10g25940-LOC_Os10g25950 intergenic_region ; MODIFIER silent_mutation Average:59.396; most accessible tissue: Zhenshan97 root, score: 69.506 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1013444607 1.27E-07 5.37E-17 mr1324 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013444607 NA 1.38E-10 mr1325 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013444607 7.72E-07 1.58E-14 mr1335 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013444607 NA 8.34E-07 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013444607 NA 4.88E-06 mr1511 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013444607 1.15E-06 2.75E-36 mr1533 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013444607 NA 3.10E-09 mr1533 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013444607 2.78E-06 1.70E-35 mr1980 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013444607 NA 1.55E-11 mr1980 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251