\
| Variant ID: vg1013420246 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 13420246 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 286. )
GGCTGGGGGTGTTTGCTCCTGAACTGCTTCGCGGGGTGCTTCGACAGTTGTTCCCTGCTGCGGCCTTGGGTTTTGCGCGTTGCCACGTTGCCTAATGTTT[C/T]
GGCATTGCTCCGTGGTGTGCGAAGAGCGTCCGTGAAAGGCGCAGTAGAGGTCTTTTCGGACCTTCTTGTGGGCTGGCTGCTGATGGTTGCTCGCTTGCTG
CAGCAAGCGAGCAACCATCAGCAGCCAGCCCACAAGAAGGTCCGAAAAGACCTCTACTGCGCCTTTCACGGACGCTCTTCGCACACCACGGAGCAATGCC[G/A]
AAACATTAGGCAACGTGGCAACGCGCAAAACCCAAGGCCGCAGCAGGGAACAACTGTCGAAGCACCCCGCGAAGCAGTTCAGGAGCAAACACCCCCAGCC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.60% | 8.30% | 0.13% | 0.00% | NA |
| All Indica | 2759 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 74.60% | 25.00% | 0.40% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 94.80% | 5.10% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 52.00% | 47.40% | 0.60% | 0.00% | NA |
| Japonica Intermediate | 241 | 57.70% | 41.50% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 10.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1013420246 | C -> T | LOC_Os10g25880.1 | downstream_gene_variant ; 4574.0bp to feature; MODIFIER | silent_mutation | Average:43.432; most accessible tissue: Zhenshan97 flag leaf, score: 62.519 | N | N | N | N |
| vg1013420246 | C -> T | LOC_Os10g25900.1 | downstream_gene_variant ; 2131.0bp to feature; MODIFIER | silent_mutation | Average:43.432; most accessible tissue: Zhenshan97 flag leaf, score: 62.519 | N | N | N | N |
| vg1013420246 | C -> T | LOC_Os10g25890.1 | intron_variant ; MODIFIER | silent_mutation | Average:43.432; most accessible tissue: Zhenshan97 flag leaf, score: 62.519 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1013420246 | NA | 8.87E-08 | mr1156 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013420246 | NA | 1.15E-07 | mr1179 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013420246 | NA | 1.55E-06 | mr1263 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013420246 | NA | 1.55E-06 | mr1451 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013420246 | NA | 1.74E-11 | mr1668 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013420246 | NA | 2.12E-09 | mr1668 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013420246 | NA | 5.07E-12 | mr1871 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013420246 | NA | 3.11E-10 | mr1980 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013420246 | NA | 1.97E-11 | mr1533_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013420246 | NA | 4.47E-07 | mr1668_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |