\
| Variant ID: vg1013382554 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 13382554 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 105. )
TGCAGGGGCGACGGGCGGCAGGCGCGGAGGAGGAGACGGAGACGGTGGCGGTGACCGGTGTGGCGGTGCCTCCCCTTTCCTCCCTCTCCTTCCGACCGCC[G/A]
ATGAGGGGGAGGGGGGGGAGGTCGCGGAACTTCAGAAGGTGGCGGGATCTGTGGCTGTTGTGATATGATACGATGAGAGAGATGCTCTATATGTGGCATT
AATGCCACATATAGAGCATCTCTCTCATCGTATCATATCACAACAGCCACAGATCCCGCCACCTTCTGAAGTTCCGCGACCTCCCCCCCCTCCCCCTCAT[C/T]
GGCGGTCGGAAGGAGAGGGAGGAAAGGGGAGGCACCGCCACACCGGTCACCGCCACCGTCTCCGTCTCCTCCTCCGCGCCTGCCGCCCGTCGCCCCTGCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 71.60% | 23.80% | 4.49% | 0.11% | NA |
| All Indica | 2759 | 67.50% | 25.00% | 7.36% | 0.18% | NA |
| All Japonica | 1512 | 74.20% | 25.50% | 0.33% | 0.00% | NA |
| Aus | 269 | 90.70% | 8.60% | 0.74% | 0.00% | NA |
| Indica I | 595 | 81.00% | 7.20% | 11.26% | 0.50% | NA |
| Indica II | 465 | 73.80% | 15.90% | 10.32% | 0.00% | NA |
| Indica III | 913 | 57.60% | 39.90% | 2.41% | 0.11% | NA |
| Indica Intermediate | 786 | 65.00% | 26.50% | 8.40% | 0.13% | NA |
| Temperate Japonica | 767 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 50.60% | 48.40% | 0.99% | 0.00% | NA |
| Japonica Intermediate | 241 | 58.10% | 41.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 3.10% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 72.20% | 26.70% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1013382554 | G -> A | LOC_Os10g25810.1 | downstream_gene_variant ; 4649.0bp to feature; MODIFIER | silent_mutation | Average:71.916; most accessible tissue: Callus, score: 87.098 | N | N | N | N |
| vg1013382554 | G -> A | LOC_Os10g25830.1 | downstream_gene_variant ; 4784.0bp to feature; MODIFIER | silent_mutation | Average:71.916; most accessible tissue: Callus, score: 87.098 | N | N | N | N |
| vg1013382554 | G -> A | LOC_Os10g25810-LOC_Os10g25830 | intergenic_region ; MODIFIER | silent_mutation | Average:71.916; most accessible tissue: Callus, score: 87.098 | N | N | N | N |
| vg1013382554 | G -> DEL | N | N | silent_mutation | Average:71.916; most accessible tissue: Callus, score: 87.098 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1013382554 | 4.89E-11 | 1.12E-48 | mr1533 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013382554 | 2.78E-10 | 4.44E-19 | mr1533 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013382554 | 7.43E-12 | 2.52E-47 | mr1980 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013382554 | 2.49E-10 | 8.44E-25 | mr1980 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013382554 | 5.95E-17 | 5.70E-57 | mr1533_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013382554 | NA | 1.91E-08 | mr1533_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013382554 | 3.80E-12 | 1.40E-27 | mr1533_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013382554 | 1.93E-13 | 8.19E-31 | mr1980_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013382554 | 3.88E-06 | 2.96E-07 | mr1980_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013382554 | 5.37E-06 | 2.81E-11 | mr1980_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |