\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1013382554:

Variant ID: vg1013382554 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 13382554
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


TGCAGGGGCGACGGGCGGCAGGCGCGGAGGAGGAGACGGAGACGGTGGCGGTGACCGGTGTGGCGGTGCCTCCCCTTTCCTCCCTCTCCTTCCGACCGCC[G/A]
ATGAGGGGGAGGGGGGGGAGGTCGCGGAACTTCAGAAGGTGGCGGGATCTGTGGCTGTTGTGATATGATACGATGAGAGAGATGCTCTATATGTGGCATT

Reverse complement sequence

AATGCCACATATAGAGCATCTCTCTCATCGTATCATATCACAACAGCCACAGATCCCGCCACCTTCTGAAGTTCCGCGACCTCCCCCCCCTCCCCCTCAT[C/T]
GGCGGTCGGAAGGAGAGGGAGGAAAGGGGAGGCACCGCCACACCGGTCACCGCCACCGTCTCCGTCTCCTCCTCCGCGCCTGCCGCCCGTCGCCCCTGCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.60% 23.80% 4.49% 0.11% NA
All Indica  2759 67.50% 25.00% 7.36% 0.18% NA
All Japonica  1512 74.20% 25.50% 0.33% 0.00% NA
Aus  269 90.70% 8.60% 0.74% 0.00% NA
Indica I  595 81.00% 7.20% 11.26% 0.50% NA
Indica II  465 73.80% 15.90% 10.32% 0.00% NA
Indica III  913 57.60% 39.90% 2.41% 0.11% NA
Indica Intermediate  786 65.00% 26.50% 8.40% 0.13% NA
Temperate Japonica  767 94.80% 5.20% 0.00% 0.00% NA
Tropical Japonica  504 50.60% 48.40% 0.99% 0.00% NA
Japonica Intermediate  241 58.10% 41.90% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 3.10% 1.04% 0.00% NA
Intermediate  90 72.20% 26.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1013382554 G -> A LOC_Os10g25810.1 downstream_gene_variant ; 4649.0bp to feature; MODIFIER silent_mutation Average:71.916; most accessible tissue: Callus, score: 87.098 N N N N
vg1013382554 G -> A LOC_Os10g25830.1 downstream_gene_variant ; 4784.0bp to feature; MODIFIER silent_mutation Average:71.916; most accessible tissue: Callus, score: 87.098 N N N N
vg1013382554 G -> A LOC_Os10g25810-LOC_Os10g25830 intergenic_region ; MODIFIER silent_mutation Average:71.916; most accessible tissue: Callus, score: 87.098 N N N N
vg1013382554 G -> DEL N N silent_mutation Average:71.916; most accessible tissue: Callus, score: 87.098 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1013382554 4.89E-11 1.12E-48 mr1533 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013382554 2.78E-10 4.44E-19 mr1533 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013382554 7.43E-12 2.52E-47 mr1980 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013382554 2.49E-10 8.44E-25 mr1980 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013382554 5.95E-17 5.70E-57 mr1533_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013382554 NA 1.91E-08 mr1533_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013382554 3.80E-12 1.40E-27 mr1533_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013382554 1.93E-13 8.19E-31 mr1980_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013382554 3.88E-06 2.96E-07 mr1980_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013382554 5.37E-06 2.81E-11 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251