\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1013340402:

Variant ID: vg1013340402 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 13340402
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 327. )

Flanking Sequence (100 bp) in Reference Genome:


CTAACCTTTATCGGGCCTAAACTAGAGCCCGTCACAGATGATACTCATCTCAATCGGGCCTAAACTAGAGCCCGTCACAGATGACTGCTGACCTCAATCG[G/A]
GCCTAAACTAGAGCCCGTCACAGATGACTACTGACCTCAATCGGGCCTAAACTAGAGCCCATCACAGATGACTATCATCTCAATCGGGCATTTAGCTATG

Reverse complement sequence

CATAGCTAAATGCCCGATTGAGATGATAGTCATCTGTGATGGGCTCTAGTTTAGGCCCGATTGAGGTCAGTAGTCATCTGTGACGGGCTCTAGTTTAGGC[C/T]
CGATTGAGGTCAGCAGTCATCTGTGACGGGCTCTAGTTTAGGCCCGATTGAGATGAGTATCATCTGTGACGGGCTCTAGTTTAGGCCCGATAAAGGTTAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.00% 21.70% 0.32% 0.00% NA
All Indica  2759 77.60% 21.80% 0.54% 0.00% NA
All Japonica  1512 73.10% 26.90% 0.00% 0.00% NA
Aus  269 98.50% 1.50% 0.00% 0.00% NA
Indica I  595 72.10% 26.90% 1.01% 0.00% NA
Indica II  465 95.90% 3.90% 0.22% 0.00% NA
Indica III  913 73.60% 25.70% 0.66% 0.00% NA
Indica Intermediate  786 75.70% 24.00% 0.25% 0.00% NA
Temperate Japonica  767 94.30% 5.70% 0.00% 0.00% NA
Tropical Japonica  504 48.00% 52.00% 0.00% 0.00% NA
Japonica Intermediate  241 58.10% 41.90% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 84.40% 15.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1013340402 G -> A LOC_Os10g25740.1 upstream_gene_variant ; 635.0bp to feature; MODIFIER silent_mutation Average:46.534; most accessible tissue: Zhenshan97 flag leaf, score: 73.475 N N N N
vg1013340402 G -> A LOC_Os10g25750.1 downstream_gene_variant ; 458.0bp to feature; MODIFIER silent_mutation Average:46.534; most accessible tissue: Zhenshan97 flag leaf, score: 73.475 N N N N
vg1013340402 G -> A LOC_Os10g25740-LOC_Os10g25750 intergenic_region ; MODIFIER silent_mutation Average:46.534; most accessible tissue: Zhenshan97 flag leaf, score: 73.475 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1013340402 3.17E-06 2.60E-09 mr1533 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013340402 1.06E-06 6.32E-15 mr1533 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013340402 3.86E-06 4.39E-09 mr1980 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013340402 NA 4.52E-16 mr1980 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013340402 NA 2.50E-06 mr1224_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013340402 NA 8.76E-06 mr1246_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013340402 NA 2.28E-07 mr1533_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013340402 5.62E-09 1.27E-22 mr1533_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013340402 NA 4.29E-10 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251