\
| Variant ID: vg1013340402 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 13340402 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 327. )
CTAACCTTTATCGGGCCTAAACTAGAGCCCGTCACAGATGATACTCATCTCAATCGGGCCTAAACTAGAGCCCGTCACAGATGACTGCTGACCTCAATCG[G/A]
GCCTAAACTAGAGCCCGTCACAGATGACTACTGACCTCAATCGGGCCTAAACTAGAGCCCATCACAGATGACTATCATCTCAATCGGGCATTTAGCTATG
CATAGCTAAATGCCCGATTGAGATGATAGTCATCTGTGATGGGCTCTAGTTTAGGCCCGATTGAGGTCAGTAGTCATCTGTGACGGGCTCTAGTTTAGGC[C/T]
CGATTGAGGTCAGCAGTCATCTGTGACGGGCTCTAGTTTAGGCCCGATTGAGATGAGTATCATCTGTGACGGGCTCTAGTTTAGGCCCGATAAAGGTTAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.00% | 21.70% | 0.32% | 0.00% | NA |
| All Indica | 2759 | 77.60% | 21.80% | 0.54% | 0.00% | NA |
| All Japonica | 1512 | 73.10% | 26.90% | 0.00% | 0.00% | NA |
| Aus | 269 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 72.10% | 26.90% | 1.01% | 0.00% | NA |
| Indica II | 465 | 95.90% | 3.90% | 0.22% | 0.00% | NA |
| Indica III | 913 | 73.60% | 25.70% | 0.66% | 0.00% | NA |
| Indica Intermediate | 786 | 75.70% | 24.00% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 94.30% | 5.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 48.00% | 52.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 58.10% | 41.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 84.40% | 15.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1013340402 | G -> A | LOC_Os10g25740.1 | upstream_gene_variant ; 635.0bp to feature; MODIFIER | silent_mutation | Average:46.534; most accessible tissue: Zhenshan97 flag leaf, score: 73.475 | N | N | N | N |
| vg1013340402 | G -> A | LOC_Os10g25750.1 | downstream_gene_variant ; 458.0bp to feature; MODIFIER | silent_mutation | Average:46.534; most accessible tissue: Zhenshan97 flag leaf, score: 73.475 | N | N | N | N |
| vg1013340402 | G -> A | LOC_Os10g25740-LOC_Os10g25750 | intergenic_region ; MODIFIER | silent_mutation | Average:46.534; most accessible tissue: Zhenshan97 flag leaf, score: 73.475 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1013340402 | 3.17E-06 | 2.60E-09 | mr1533 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013340402 | 1.06E-06 | 6.32E-15 | mr1533 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013340402 | 3.86E-06 | 4.39E-09 | mr1980 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013340402 | NA | 4.52E-16 | mr1980 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013340402 | NA | 2.50E-06 | mr1224_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013340402 | NA | 8.76E-06 | mr1246_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013340402 | NA | 2.28E-07 | mr1533_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013340402 | 5.62E-09 | 1.27E-22 | mr1533_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013340402 | NA | 4.29E-10 | mr1980_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |