\
| Variant ID: vg1013333671 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 13333671 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ACTCGAACGCTTCAATTTTCTTAAGATAATGGACGAAAGTCTGCCTTCAATTCAACAAAAGCTACAACCAATTATTACATAATTATTGGCTTAAAGCCCC[G/A]
AAACTTAGCTACCATAAAATGAAATGGAAGACAAATAACAACTCCACCAAAAGAAGTGATATAACTTATTCAAACAACAATCCTATTAGAAAATAGGCAT
ATGCCTATTTTCTAATAGGATTGTTGTTTGAATAAGTTATATCACTTCTTTTGGTGGAGTTGTTATTTGTCTTCCATTTCATTTTATGGTAGCTAAGTTT[C/T]
GGGGCTTTAAGCCAATAATTATGTAATAATTGGTTGTAGCTTTTGTTGAATTGAAGGCAGACTTTCGTCCATTATCTTAAGAAAATTGAAGCGTTCGAGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.90% | 3.60% | 0.49% | 0.00% | NA |
| All Indica | 2759 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 87.70% | 10.80% | 1.52% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 81.40% | 15.90% | 2.74% | 0.00% | NA |
| Tropical Japonica | 504 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 84.60% | 14.50% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1013333671 | G -> A | LOC_Os10g25730-LOC_Os10g25740 | intergenic_region ; MODIFIER | silent_mutation | Average:31.385; most accessible tissue: Minghui63 root, score: 43.505 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1013333671 | 1.66E-06 | NA | mr1027_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013333671 | NA | 8.23E-06 | mr1027_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013333671 | 6.37E-06 | 6.37E-06 | mr1081_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013333671 | 1.62E-07 | NA | mr1137_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013333671 | 7.03E-06 | 6.98E-06 | mr1197_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013333671 | NA | 4.65E-07 | mr1275_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013333671 | 9.75E-06 | 9.70E-06 | mr1413_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013333671 | 7.74E-07 | NA | mr1617_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013333671 | 3.69E-06 | NA | mr1980_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |