| Variant ID: vg1013325243 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 13325243 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
ATGACCTAGCTAGAACTATATGCTTAGCCATGCTTAATTACCACTAGCTCAGTCGATGGGATAATTGCAGTATTAGACATTCTAGTATCTTGTTGAGCTG[C/T]
GTGCTCGAGACATCTGGCCAAGTTCTATGGTCGTAATTATCCAACTAAAATGTGACTGAATGGTGGGCTGTGGGTGCATGGTTTTGCGAGTCGCACCCAT
ATGGGTGCGACTCGCAAAACCATGCACCCACAGCCCACCATTCAGTCACATTTTAGTTGGATAATTACGACCATAGAACTTGGCCAGATGTCTCGAGCAC[G/A]
CAGCTCAACAAGATACTAGAATGTCTAATACTGCAATTATCCCATCGACTGAGCTAGTGGTAATTAAGCATGGCTAAGCATATAGTTCTAGCTAGGTCAT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 47.80% | 32.50% | 15.74% | 3.91% | NA |
| All Indica | 2759 | 73.60% | 4.50% | 21.17% | 0.76% | NA |
| All Japonica | 1512 | 1.00% | 84.90% | 3.37% | 10.78% | NA |
| Aus | 269 | 71.00% | 3.00% | 26.02% | 0.00% | NA |
| Indica I | 595 | 88.10% | 1.80% | 8.57% | 1.51% | NA |
| Indica II | 465 | 79.80% | 3.70% | 16.56% | 0.00% | NA |
| Indica III | 913 | 60.60% | 4.70% | 34.39% | 0.33% | NA |
| Indica Intermediate | 786 | 74.00% | 6.70% | 18.07% | 1.15% | NA |
| Temperate Japonica | 767 | 0.30% | 97.00% | 0.39% | 2.35% | NA |
| Tropical Japonica | 504 | 1.20% | 70.20% | 7.74% | 20.83% | NA |
| Japonica Intermediate | 241 | 2.90% | 76.80% | 3.73% | 16.60% | NA |
| VI/Aromatic | 96 | 5.20% | 77.10% | 17.71% | 0.00% | NA |
| Intermediate | 90 | 22.20% | 52.20% | 24.44% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1013325243 | C -> T | LOC_Os10g25720.1 | downstream_gene_variant ; 2922.0bp to feature; MODIFIER | silent_mutation | Average:16.169; most accessible tissue: Minghui63 panicle, score: 25.313 | N | N | N | N |
| vg1013325243 | C -> T | LOC_Os10g25730.1 | downstream_gene_variant ; 1982.0bp to feature; MODIFIER | silent_mutation | Average:16.169; most accessible tissue: Minghui63 panicle, score: 25.313 | N | N | N | N |
| vg1013325243 | C -> T | LOC_Os10g25720-LOC_Os10g25730 | intergenic_region ; MODIFIER | silent_mutation | Average:16.169; most accessible tissue: Minghui63 panicle, score: 25.313 | N | N | N | N |
| vg1013325243 | C -> DEL | N | N | silent_mutation | Average:16.169; most accessible tissue: Minghui63 panicle, score: 25.313 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1013325243 | NA | 4.20E-06 | mr1038 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013325243 | NA | 4.24E-06 | mr1207 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013325243 | NA | 7.36E-06 | mr1209 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013325243 | NA | 1.90E-06 | mr1389 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013325243 | 2.88E-06 | 1.99E-07 | mr1898 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |