Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1013279779:

Variant ID: vg1013279779 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 13279779
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, A: 0.04, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:

CCTCAGCTATAGCTGTTGCTATTCTTCAGTTATAAATGTTTAAGAAGGGTCCAACTATTTGCTTTCATATACAATTTAACTATAATAGCTCCATTTAACC[C/A]
ACTATAGATATAGTTATTTAAGAAACCCAACCGCTAAATGTCTTAGCTCACTATTTAAAATATTGATGATGAAGGAAACAACAAGAGAAAAGTAGAGAGA

Reverse complement sequence

TCTCTCTACTTTTCTCTTGTTGTTTCCTTCATCATCAATATTTTAAATAGTGAGCTAAGACATTTAGCGGTTGGGTTTCTTAAATAACTATATCTATAGT[G/T]
GGTTAAATGGAGCTATTATAGTTAAATTGTATATGAAAGCAAATAGTTGGACCCTTCTTAAACATTTATAACTGAAGAATAGCAACAGCTATAGCTGAGG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.60%	21.40%	0.00%	0.00%	NA
All Indica	2759	75.10%	24.90%	0.00%	0.00%	NA
All Japonica	1512	99.10%	0.90%	0.00%	0.00%	NA
Aus	269	1.10%	98.90%	0.00%	0.00%	NA
Indica I	595	71.80%	28.20%	0.00%	0.00%	NA
Indica II	465	94.40%	5.60%	0.00%	0.00%	NA
Indica III	913	70.10%	29.90%	0.00%	0.00%	NA
Indica Intermediate	786	72.10%	27.90%	0.00%	0.00%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	98.00%	2.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	69.80%	30.20%	0.00%	0.00%	NA
Intermediate	90	82.20%	17.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1013279779	C -> A	LOC_Os10g25630.1	upstream_gene_variant ; 799.0bp to feature; MODIFIER	silent_mutation	Average:57.447; most accessible tissue: Zhenshan97 panicle, score: 73.605	N	N	N	N
vg1013279779	C -> A	LOC_Os10g25660.1	downstream_gene_variant ; 4230.0bp to feature; MODIFIER	silent_mutation	Average:57.447; most accessible tissue: Zhenshan97 panicle, score: 73.605	N	N	N	N
vg1013279779	C -> A	LOC_Os10g25640.1	intron_variant ; MODIFIER	silent_mutation	Average:57.447; most accessible tissue: Zhenshan97 panicle, score: 73.605	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1013279779	1.53E-11	NA	mr1533	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013279779	5.62E-13	3.73E-19	mr1533	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013279779	1.87E-11	NA	mr1980	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013279779	6.86E-13	5.74E-19	mr1980	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013279779	NA	9.08E-06	mr1173_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013279779	4.36E-06	4.36E-06	mr1173_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013279779	4.77E-12	NA	mr1533_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013279779	2.01E-13	1.29E-23	mr1533_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013279779	NA	7.78E-09	mr1980_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251