\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1013279779:

Variant ID: vg1013279779 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 13279779
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, A: 0.04, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


CCTCAGCTATAGCTGTTGCTATTCTTCAGTTATAAATGTTTAAGAAGGGTCCAACTATTTGCTTTCATATACAATTTAACTATAATAGCTCCATTTAACC[C/A]
ACTATAGATATAGTTATTTAAGAAACCCAACCGCTAAATGTCTTAGCTCACTATTTAAAATATTGATGATGAAGGAAACAACAAGAGAAAAGTAGAGAGA

Reverse complement sequence

TCTCTCTACTTTTCTCTTGTTGTTTCCTTCATCATCAATATTTTAAATAGTGAGCTAAGACATTTAGCGGTTGGGTTTCTTAAATAACTATATCTATAGT[G/T]
GGTTAAATGGAGCTATTATAGTTAAATTGTATATGAAAGCAAATAGTTGGACCCTTCTTAAACATTTATAACTGAAGAATAGCAACAGCTATAGCTGAGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.60% 21.40% 0.00% 0.00% NA
All Indica  2759 75.10% 24.90% 0.00% 0.00% NA
All Japonica  1512 99.10% 0.90% 0.00% 0.00% NA
Aus  269 1.10% 98.90% 0.00% 0.00% NA
Indica I  595 71.80% 28.20% 0.00% 0.00% NA
Indica II  465 94.40% 5.60% 0.00% 0.00% NA
Indica III  913 70.10% 29.90% 0.00% 0.00% NA
Indica Intermediate  786 72.10% 27.90% 0.00% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 98.00% 2.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 69.80% 30.20% 0.00% 0.00% NA
Intermediate  90 82.20% 17.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1013279779 C -> A LOC_Os10g25630.1 upstream_gene_variant ; 799.0bp to feature; MODIFIER silent_mutation Average:57.447; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N
vg1013279779 C -> A LOC_Os10g25660.1 downstream_gene_variant ; 4230.0bp to feature; MODIFIER silent_mutation Average:57.447; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N
vg1013279779 C -> A LOC_Os10g25640.1 intron_variant ; MODIFIER silent_mutation Average:57.447; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1013279779 1.53E-11 NA mr1533 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013279779 5.62E-13 3.73E-19 mr1533 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013279779 1.87E-11 NA mr1980 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013279779 6.86E-13 5.74E-19 mr1980 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013279779 NA 9.08E-06 mr1173_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013279779 4.36E-06 4.36E-06 mr1173_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013279779 4.77E-12 NA mr1533_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013279779 2.01E-13 1.29E-23 mr1533_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013279779 NA 7.78E-09 mr1980_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251