\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1013277454:

Variant ID: vg1013277454 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 13277454
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, A: 0.07, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:


TAAAGCAACACATGACTTCATATGGTCGCTATAGGCTAATTTGGAGCTTGGGCAAGTTTTTTTTTTCTTGTTAGTCCCCCTTATGCATGCCTACACATAG[C/A]
AAAGAACATGTTGCTATTTTCCAGATATGAATTCTCCCTGAATAGTAAAATAATAGCTATGAACCCCTTTGTCTATGGCCCATAAATGGATTATTCATCT

Reverse complement sequence

AGATGAATAATCCATTTATGGGCCATAGACAAAGGGGTTCATAGCTATTATTTTACTATTCAGGGAGAATTCATATCTGGAAAATAGCAACATGTTCTTT[G/T]
CTATGTGTAGGCATGCATAAGGGGGACTAACAAGAAAAAAAAAACTTGCCCAAGCTCCAAATTAGCCTATAGCGACCATATGAAGTCATGTGTTGCTTTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.20% 21.50% 0.25% 0.00% NA
All Indica  2759 74.60% 25.00% 0.43% 0.00% NA
All Japonica  1512 99.10% 0.90% 0.00% 0.00% NA
Aus  269 1.10% 98.90% 0.00% 0.00% NA
Indica I  595 70.60% 28.60% 0.84% 0.00% NA
Indica II  465 93.80% 5.80% 0.43% 0.00% NA
Indica III  913 70.00% 29.90% 0.11% 0.00% NA
Indica Intermediate  786 71.60% 27.90% 0.51% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 98.00% 2.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 68.80% 31.20% 0.00% 0.00% NA
Intermediate  90 81.10% 18.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1013277454 C -> A LOC_Os10g25620.1 upstream_gene_variant ; 4507.0bp to feature; MODIFIER silent_mutation Average:56.032; most accessible tissue: Callus, score: 83.369 N N N N
vg1013277454 C -> A LOC_Os10g25630.1 downstream_gene_variant ; 384.0bp to feature; MODIFIER silent_mutation Average:56.032; most accessible tissue: Callus, score: 83.369 N N N N
vg1013277454 C -> A LOC_Os10g25640.1 downstream_gene_variant ; 1899.0bp to feature; MODIFIER silent_mutation Average:56.032; most accessible tissue: Callus, score: 83.369 N N N N
vg1013277454 C -> A LOC_Os10g25620-LOC_Os10g25630 intergenic_region ; MODIFIER silent_mutation Average:56.032; most accessible tissue: Callus, score: 83.369 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1013277454 8.38E-12 NA mr1533 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013277454 4.53E-13 4.25E-19 mr1533 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013277454 3.49E-13 NA mr1980 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013277454 1.59E-13 1.88E-19 mr1980 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013277454 2.63E-13 NA mr1533_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013277454 1.57E-14 8.03E-25 mr1533_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013277454 9.89E-06 1.30E-09 mr1980_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251