Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1013277454:

Variant ID: vg1013277454 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 13277454
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, A: 0.07, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:

TAAAGCAACACATGACTTCATATGGTCGCTATAGGCTAATTTGGAGCTTGGGCAAGTTTTTTTTTTCTTGTTAGTCCCCCTTATGCATGCCTACACATAG[C/A]
AAAGAACATGTTGCTATTTTCCAGATATGAATTCTCCCTGAATAGTAAAATAATAGCTATGAACCCCTTTGTCTATGGCCCATAAATGGATTATTCATCT

Reverse complement sequence

AGATGAATAATCCATTTATGGGCCATAGACAAAGGGGTTCATAGCTATTATTTTACTATTCAGGGAGAATTCATATCTGGAAAATAGCAACATGTTCTTT[G/T]
CTATGTGTAGGCATGCATAAGGGGGACTAACAAGAAAAAAAAAACTTGCCCAAGCTCCAAATTAGCCTATAGCGACCATATGAAGTCATGTGTTGCTTTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.20%	21.50%	0.25%	0.00%	NA
All Indica	2759	74.60%	25.00%	0.43%	0.00%	NA
All Japonica	1512	99.10%	0.90%	0.00%	0.00%	NA
Aus	269	1.10%	98.90%	0.00%	0.00%	NA
Indica I	595	70.60%	28.60%	0.84%	0.00%	NA
Indica II	465	93.80%	5.80%	0.43%	0.00%	NA
Indica III	913	70.00%	29.90%	0.11%	0.00%	NA
Indica Intermediate	786	71.60%	27.90%	0.51%	0.00%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	98.00%	2.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	68.80%	31.20%	0.00%	0.00%	NA
Intermediate	90	81.10%	18.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1013277454	C -> A	LOC_Os10g25620.1	upstream_gene_variant ; 4507.0bp to feature; MODIFIER	silent_mutation	Average:56.032; most accessible tissue: Callus, score: 83.369	N	N	N	N
vg1013277454	C -> A	LOC_Os10g25630.1	downstream_gene_variant ; 384.0bp to feature; MODIFIER	silent_mutation	Average:56.032; most accessible tissue: Callus, score: 83.369	N	N	N	N
vg1013277454	C -> A	LOC_Os10g25640.1	downstream_gene_variant ; 1899.0bp to feature; MODIFIER	silent_mutation	Average:56.032; most accessible tissue: Callus, score: 83.369	N	N	N	N
vg1013277454	C -> A	LOC_Os10g25620-LOC_Os10g25630	intergenic_region ; MODIFIER	silent_mutation	Average:56.032; most accessible tissue: Callus, score: 83.369	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1013277454	8.38E-12	NA	mr1533	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013277454	4.53E-13	4.25E-19	mr1533	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013277454	3.49E-13	NA	mr1980	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013277454	1.59E-13	1.88E-19	mr1980	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013277454	2.63E-13	NA	mr1533_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013277454	1.57E-14	8.03E-25	mr1533_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013277454	9.89E-06	1.30E-09	mr1980_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251