| Variant ID: vg1013277454 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 13277454 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, A: 0.07, others allele: 0.00, population size: 209. )
TAAAGCAACACATGACTTCATATGGTCGCTATAGGCTAATTTGGAGCTTGGGCAAGTTTTTTTTTTCTTGTTAGTCCCCCTTATGCATGCCTACACATAG[C/A]
AAAGAACATGTTGCTATTTTCCAGATATGAATTCTCCCTGAATAGTAAAATAATAGCTATGAACCCCTTTGTCTATGGCCCATAAATGGATTATTCATCT
AGATGAATAATCCATTTATGGGCCATAGACAAAGGGGTTCATAGCTATTATTTTACTATTCAGGGAGAATTCATATCTGGAAAATAGCAACATGTTCTTT[G/T]
CTATGTGTAGGCATGCATAAGGGGGACTAACAAGAAAAAAAAAACTTGCCCAAGCTCCAAATTAGCCTATAGCGACCATATGAAGTCATGTGTTGCTTTA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.20% | 21.50% | 0.25% | 0.00% | NA |
| All Indica | 2759 | 74.60% | 25.00% | 0.43% | 0.00% | NA |
| All Japonica | 1512 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Aus | 269 | 1.10% | 98.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 70.60% | 28.60% | 0.84% | 0.00% | NA |
| Indica II | 465 | 93.80% | 5.80% | 0.43% | 0.00% | NA |
| Indica III | 913 | 70.00% | 29.90% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 71.60% | 27.90% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.00% | 2.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 68.80% | 31.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 81.10% | 18.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1013277454 | C -> A | LOC_Os10g25620.1 | upstream_gene_variant ; 4507.0bp to feature; MODIFIER | silent_mutation | Average:56.032; most accessible tissue: Callus, score: 83.369 | N | N | N | N |
| vg1013277454 | C -> A | LOC_Os10g25630.1 | downstream_gene_variant ; 384.0bp to feature; MODIFIER | silent_mutation | Average:56.032; most accessible tissue: Callus, score: 83.369 | N | N | N | N |
| vg1013277454 | C -> A | LOC_Os10g25640.1 | downstream_gene_variant ; 1899.0bp to feature; MODIFIER | silent_mutation | Average:56.032; most accessible tissue: Callus, score: 83.369 | N | N | N | N |
| vg1013277454 | C -> A | LOC_Os10g25620-LOC_Os10g25630 | intergenic_region ; MODIFIER | silent_mutation | Average:56.032; most accessible tissue: Callus, score: 83.369 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1013277454 | 8.38E-12 | NA | mr1533 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013277454 | 4.53E-13 | 4.25E-19 | mr1533 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013277454 | 3.49E-13 | NA | mr1980 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013277454 | 1.59E-13 | 1.88E-19 | mr1980 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013277454 | 2.63E-13 | NA | mr1533_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013277454 | 1.57E-14 | 8.03E-25 | mr1533_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013277454 | 9.89E-06 | 1.30E-09 | mr1980_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |