\
| Variant ID: vg1013275569 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 13275569 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AGCTTCCCATTTCTTTATCTGTTTGTTACTGTTTCTAAATATTTTTAAAAATGTTTGACCGTTTATCTTATTTAGTAATTATTAATTTTTTTTATCATTT[G/A]
ATTTATTGTTAAATATAATTTTATGTACCCATATAGTTTTACATATTTCATAAAAATTTTTAAATAAAACGAACAGTTAAATATATATTTAAAATGTCAA
TTGACATTTTAAATATATATTTAACTGTTCGTTTTATTTAAAAATTTTTATGAAATATGTAAAACTATATGGGTACATAAAATTATATTTAACAATAAAT[C/T]
AAATGATAAAAAAAATTAATAATTACTAAATAAGATAAACGGTCAAACATTTTTAAAAATATTTAGAAACAGTAACAAACAGATAAAGAAATGGGAAGCT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.60% | 21.40% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 75.20% | 24.80% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 1.50% | 98.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 71.90% | 28.10% | 0.00% | 0.00% | NA |
| Indica II | 465 | 94.60% | 5.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 70.10% | 29.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 72.00% | 28.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 97.60% | 2.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 69.80% | 30.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 17.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1013275569 | G -> A | LOC_Os10g25620.1 | upstream_gene_variant ; 2622.0bp to feature; MODIFIER | silent_mutation | Average:61.096; most accessible tissue: Callus, score: 86.328 | N | N | N | N |
| vg1013275569 | G -> A | LOC_Os10g25630.1 | downstream_gene_variant ; 2269.0bp to feature; MODIFIER | silent_mutation | Average:61.096; most accessible tissue: Callus, score: 86.328 | N | N | N | N |
| vg1013275569 | G -> A | LOC_Os10g25640.1 | downstream_gene_variant ; 3784.0bp to feature; MODIFIER | silent_mutation | Average:61.096; most accessible tissue: Callus, score: 86.328 | N | N | N | N |
| vg1013275569 | G -> A | LOC_Os10g25620-LOC_Os10g25630 | intergenic_region ; MODIFIER | silent_mutation | Average:61.096; most accessible tissue: Callus, score: 86.328 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1013275569 | 3.60E-12 | NA | mr1533 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013275569 | 9.16E-14 | 7.50E-20 | mr1533 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013275569 | NA | 2.63E-06 | mr1665 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013275569 | NA | 9.76E-06 | mr1833 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013275569 | 1.84E-12 | NA | mr1980 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013275569 | 3.33E-14 | 2.09E-20 | mr1980 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013275569 | 5.23E-15 | NA | mr1533_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013275569 | 3.94E-15 | 2.22E-25 | mr1533_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013275569 | 8.16E-07 | NA | mr1980_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013275569 | 1.10E-06 | 9.78E-11 | mr1980_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |