Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1013275569:

Variant ID: vg1013275569 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 13275569
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGCTTCCCATTTCTTTATCTGTTTGTTACTGTTTCTAAATATTTTTAAAAATGTTTGACCGTTTATCTTATTTAGTAATTATTAATTTTTTTTATCATTT[G/A]
ATTTATTGTTAAATATAATTTTATGTACCCATATAGTTTTACATATTTCATAAAAATTTTTAAATAAAACGAACAGTTAAATATATATTTAAAATGTCAA

Reverse complement sequence

TTGACATTTTAAATATATATTTAACTGTTCGTTTTATTTAAAAATTTTTATGAAATATGTAAAACTATATGGGTACATAAAATTATATTTAACAATAAAT[C/T]
AAATGATAAAAAAAATTAATAATTACTAAATAAGATAAACGGTCAAACATTTTTAAAAATATTTAGAAACAGTAACAAACAGATAAAGAAATGGGAAGCT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.60%	21.40%	0.00%	0.00%	NA
All Indica	2759	75.20%	24.80%	0.00%	0.00%	NA
All Japonica	1512	98.90%	1.10%	0.00%	0.00%	NA
Aus	269	1.50%	98.50%	0.00%	0.00%	NA
Indica I	595	71.90%	28.10%	0.00%	0.00%	NA
Indica II	465	94.60%	5.40%	0.00%	0.00%	NA
Indica III	913	70.10%	29.90%	0.00%	0.00%	NA
Indica Intermediate	786	72.00%	28.00%	0.00%	0.00%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	97.60%	2.40%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	69.80%	30.20%	0.00%	0.00%	NA
Intermediate	90	82.20%	17.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1013275569	G -> A	LOC_Os10g25620.1	upstream_gene_variant ; 2622.0bp to feature; MODIFIER	silent_mutation	Average:61.096; most accessible tissue: Callus, score: 86.328	N	N	N	N
vg1013275569	G -> A	LOC_Os10g25630.1	downstream_gene_variant ; 2269.0bp to feature; MODIFIER	silent_mutation	Average:61.096; most accessible tissue: Callus, score: 86.328	N	N	N	N
vg1013275569	G -> A	LOC_Os10g25640.1	downstream_gene_variant ; 3784.0bp to feature; MODIFIER	silent_mutation	Average:61.096; most accessible tissue: Callus, score: 86.328	N	N	N	N
vg1013275569	G -> A	LOC_Os10g25620-LOC_Os10g25630	intergenic_region ; MODIFIER	silent_mutation	Average:61.096; most accessible tissue: Callus, score: 86.328	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1013275569	3.60E-12	NA	mr1533	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013275569	9.16E-14	7.50E-20	mr1533	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013275569	NA	2.63E-06	mr1665	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013275569	NA	9.76E-06	mr1833	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013275569	1.84E-12	NA	mr1980	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013275569	3.33E-14	2.09E-20	mr1980	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013275569	5.23E-15	NA	mr1533_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013275569	3.94E-15	2.22E-25	mr1533_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013275569	8.16E-07	NA	mr1980_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013275569	1.10E-06	9.78E-11	mr1980_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251