\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1013275569:

Variant ID: vg1013275569 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 13275569
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGCTTCCCATTTCTTTATCTGTTTGTTACTGTTTCTAAATATTTTTAAAAATGTTTGACCGTTTATCTTATTTAGTAATTATTAATTTTTTTTATCATTT[G/A]
ATTTATTGTTAAATATAATTTTATGTACCCATATAGTTTTACATATTTCATAAAAATTTTTAAATAAAACGAACAGTTAAATATATATTTAAAATGTCAA

Reverse complement sequence

TTGACATTTTAAATATATATTTAACTGTTCGTTTTATTTAAAAATTTTTATGAAATATGTAAAACTATATGGGTACATAAAATTATATTTAACAATAAAT[C/T]
AAATGATAAAAAAAATTAATAATTACTAAATAAGATAAACGGTCAAACATTTTTAAAAATATTTAGAAACAGTAACAAACAGATAAAGAAATGGGAAGCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.60% 21.40% 0.00% 0.00% NA
All Indica  2759 75.20% 24.80% 0.00% 0.00% NA
All Japonica  1512 98.90% 1.10% 0.00% 0.00% NA
Aus  269 1.50% 98.50% 0.00% 0.00% NA
Indica I  595 71.90% 28.10% 0.00% 0.00% NA
Indica II  465 94.60% 5.40% 0.00% 0.00% NA
Indica III  913 70.10% 29.90% 0.00% 0.00% NA
Indica Intermediate  786 72.00% 28.00% 0.00% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 97.60% 2.40% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 69.80% 30.20% 0.00% 0.00% NA
Intermediate  90 82.20% 17.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1013275569 G -> A LOC_Os10g25620.1 upstream_gene_variant ; 2622.0bp to feature; MODIFIER silent_mutation Average:61.096; most accessible tissue: Callus, score: 86.328 N N N N
vg1013275569 G -> A LOC_Os10g25630.1 downstream_gene_variant ; 2269.0bp to feature; MODIFIER silent_mutation Average:61.096; most accessible tissue: Callus, score: 86.328 N N N N
vg1013275569 G -> A LOC_Os10g25640.1 downstream_gene_variant ; 3784.0bp to feature; MODIFIER silent_mutation Average:61.096; most accessible tissue: Callus, score: 86.328 N N N N
vg1013275569 G -> A LOC_Os10g25620-LOC_Os10g25630 intergenic_region ; MODIFIER silent_mutation Average:61.096; most accessible tissue: Callus, score: 86.328 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1013275569 3.60E-12 NA mr1533 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013275569 9.16E-14 7.50E-20 mr1533 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013275569 NA 2.63E-06 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013275569 NA 9.76E-06 mr1833 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013275569 1.84E-12 NA mr1980 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013275569 3.33E-14 2.09E-20 mr1980 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013275569 5.23E-15 NA mr1533_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013275569 3.94E-15 2.22E-25 mr1533_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013275569 8.16E-07 NA mr1980_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013275569 1.10E-06 9.78E-11 mr1980_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251