\
| Variant ID: vg1013156252 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 13156252 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.67, A: 0.33, others allele: 0.00, population size: 88. )
AAGGGTAAAATTGTCATTTCATTCATACTGCTGCATGCGAGGATGACTTAGCATGCTCACGTGGTATTTTTATGGGTCCAAGGACTATATTAACCCAAAT[G/A]
ATTAATTTGGGGGACTTGTTTGGATGATTTGAAACCTCAATGACCAAGCTGAGCCCGAAACGAAACTCAAGAACCATATGAGCTATTCACCCAAATTTAA
TTAAATTTGGGTGAATAGCTCATATGGTTCTTGAGTTTCGTTTCGGGCTCAGCTTGGTCATTGAGGTTTCAAATCATCCAAACAAGTCCCCCAAATTAAT[C/T]
ATTTGGGTTAATATAGTCCTTGGACCCATAAAAATACCACGTGAGCATGCTAAGTCATCCTCGCATGCAGCAGTATGAATGAAATGACAATTTTACCCTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.50% | 16.40% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 83.60% | 16.30% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 79.80% | 20.00% | 0.13% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 39.80% | 59.80% | 0.34% | 0.00% | NA |
| Indica II | 465 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 89.70% | 10.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 54.60% | 45.00% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 76.80% | 23.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 89.60% | 10.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 87.80% | 12.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1013156252 | G -> A | LOC_Os10g25430.1 | upstream_gene_variant ; 2262.0bp to feature; MODIFIER | silent_mutation | Average:41.856; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| vg1013156252 | G -> A | LOC_Os10g25450.1 | upstream_gene_variant ; 4039.0bp to feature; MODIFIER | silent_mutation | Average:41.856; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| vg1013156252 | G -> A | LOC_Os10g25430-LOC_Os10g25450 | intergenic_region ; MODIFIER | silent_mutation | Average:41.856; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1013156252 | NA | 1.80E-12 | mr1026 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013156252 | NA | 5.32E-10 | mr1161 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013156252 | 1.09E-08 | NA | mr1533 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013156252 | 4.86E-08 | 5.35E-16 | mr1533 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013156252 | 5.83E-09 | NA | mr1980 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013156252 | NA | 6.51E-15 | mr1980 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013156252 | NA | 3.30E-09 | mr1161_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013156252 | 3.78E-12 | NA | mr1533_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013156252 | 1.91E-09 | 7.03E-21 | mr1533_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013156252 | NA | 1.16E-07 | mr1578_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013156252 | NA | 2.81E-07 | mr1745_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013156252 | NA | 2.84E-06 | mr1843_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013156252 | NA | 3.52E-07 | mr1904_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013156252 | NA | 2.75E-07 | mr1952_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013156252 | 5.68E-06 | NA | mr1980_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013156252 | NA | 1.09E-09 | mr1980_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |