\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1013130507:

Variant ID: vg1013130507 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 13130507
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.96, C: 0.04, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


TCCCTTCTGGACCGCGTCGGCTTTATTGGTTGTGGGCCAAACCCAGGCTAGCCCAACCCTCCTAGCTTCATTAATTCTAACACGGCATCAAAGGGAGCAA[A/C]
ATGTCAGGGAAATTAAATTTGGTTTGCAGTGTTCGCGAAATAAACACGATTATTACATGACTCTTCCTCCTTGTCGTCGACGACGTCGTTGATCCTGCGT

Reverse complement sequence

ACGCAGGATCAACGACGTCGTCGACGACAAGGAGGAAGAGTCATGTAATAATCGTGTTTATTTCGCGAACACTGCAAACCAAATTTAATTTCCCTGACAT[T/G]
TTGCTCCCTTTGATGCCGTGTTAGAATTAATGAAGCTAGGAGGGTTGGGCTAGCCTGGGTTTGGCCCACAACCAATAAAGCCGACGCGGTCCAGAAGGGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.70% 23.30% 0.04% 0.00% NA
All Indica  2759 82.00% 17.90% 0.07% 0.00% NA
All Japonica  1512 79.80% 20.20% 0.00% 0.00% NA
Aus  269 8.20% 91.80% 0.00% 0.00% NA
Indica I  595 40.20% 59.70% 0.17% 0.00% NA
Indica II  465 96.60% 3.40% 0.00% 0.00% NA
Indica III  913 98.00% 2.00% 0.00% 0.00% NA
Indica Intermediate  786 86.40% 13.50% 0.13% 0.00% NA
Temperate Japonica  767 97.40% 2.60% 0.00% 0.00% NA
Tropical Japonica  504 54.40% 45.60% 0.00% 0.00% NA
Japonica Intermediate  241 77.20% 22.80% 0.00% 0.00% NA
VI/Aromatic  96 66.70% 33.30% 0.00% 0.00% NA
Intermediate  90 77.80% 22.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1013130507 A -> C LOC_Os10g25400.1 upstream_gene_variant ; 926.0bp to feature; MODIFIER silent_mutation Average:93.689; most accessible tissue: Zhenshan97 young leaf, score: 98.802 N N N N
vg1013130507 A -> C LOC_Os10g25380.1 downstream_gene_variant ; 2965.0bp to feature; MODIFIER silent_mutation Average:93.689; most accessible tissue: Zhenshan97 young leaf, score: 98.802 N N N N
vg1013130507 A -> C LOC_Os10g25380-LOC_Os10g25400 intergenic_region ; MODIFIER silent_mutation Average:93.689; most accessible tissue: Zhenshan97 young leaf, score: 98.802 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1013130507 A C 0.1 0.06 0.02 0.05 0.1 0.13

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1013130507 NA 1.32E-11 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013130507 NA 1.81E-09 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013130507 NA 3.89E-06 mr1207 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013130507 4.82E-08 NA mr1533 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013130507 1.96E-09 4.61E-17 mr1533 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013130507 NA 3.54E-07 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013130507 NA 5.62E-09 mr1942 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013130507 3.30E-09 NA mr1980 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013130507 6.97E-06 1.76E-15 mr1980 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013130507 2.16E-10 NA mr1533_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013130507 4.76E-08 4.05E-19 mr1533_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013130507 NA 1.40E-06 mr1745_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013130507 NA 7.95E-06 mr1835_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013130507 NA 2.87E-07 mr1904_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013130507 NA 4.57E-09 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251