Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1013103415:

Variant ID: vg1013103415 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 13103415
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.06, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:

ATAAACGGGGTAGCGCACGAGATTTAAAAGTGGATGGATGCGGAGACAATAAATTTTAGACAGTTCAGACCCTCTCAATGAGAGACAATACCCTAATCTT[G/A]
TTTGAGGATTTGAATCCGCCGGGTTGTGTATTGATCTAACGATCTGAGTTGTAATTCTATATGCTCATGCCCCTTAGAGGGGGCTCCCTGCCCACCTTAT

Reverse complement sequence

ATAAGGTGGGCAGGGAGCCCCCTCTAAGGGGCATGAGCATATAGAATTACAACTCAGATCGTTAGATCAATACACAACCCGGCGGATTCAAATCCTCAAA[C/T]
AAGATTAGGGTATTGTCTCTCATTGAGAGGGTCTGAACTGTCTAAAATTTATTGTCTCCGCATCCATCCACTTTTAAATCTCGTGCGCTACCCCGTTTAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.80%	16.00%	0.23%	0.00%	NA
All Indica	2759	83.10%	16.60%	0.25%	0.00%	NA
All Japonica	1512	81.60%	18.30%	0.07%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	38.50%	61.50%	0.00%	0.00%	NA
Indica II	465	97.20%	2.40%	0.43%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	89.10%	10.30%	0.64%	0.00%	NA
Temperate Japonica	767	97.40%	2.60%	0.00%	0.00%	NA
Tropical Japonica	504	59.50%	40.30%	0.20%	0.00%	NA
Japonica Intermediate	241	77.60%	22.40%	0.00%	0.00%	NA
VI/Aromatic	96	91.70%	7.30%	1.04%	0.00%	NA
Intermediate	90	84.40%	13.30%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1013103415	G -> A	LOC_Os10g25340.1	upstream_gene_variant ; 1324.0bp to feature; MODIFIER	silent_mutation	Average:56.972; most accessible tissue: Zhenshan97 root, score: 68.289	N	N	N	N
vg1013103415	G -> A	LOC_Os10g25330.1	downstream_gene_variant ; 1926.0bp to feature; MODIFIER	silent_mutation	Average:56.972; most accessible tissue: Zhenshan97 root, score: 68.289	N	N	N	N
vg1013103415	G -> A	LOC_Os10g25330-LOC_Os10g25340	intergenic_region ; MODIFIER	silent_mutation	Average:56.972; most accessible tissue: Zhenshan97 root, score: 68.289	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1013103415	NA	3.52E-12	mr1026	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013103415	NA	9.81E-10	mr1161	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013103415	8.80E-08	NA	mr1533	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013103415	3.43E-07	1.87E-14	mr1533	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013103415	NA	1.81E-08	mr1565	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013103415	1.22E-07	NA	mr1980	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013103415	NA	1.60E-13	mr1980	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013103415	2.75E-12	NA	mr1533_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013103415	8.09E-09	1.57E-20	mr1533_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013103415	NA	6.74E-07	mr1745_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013103415	NA	6.76E-06	mr1843_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013103415	NA	4.17E-07	mr1904_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013103415	6.72E-06	NA	mr1980_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013103415	NA	4.56E-09	mr1980_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251