\
| Variant ID: vg1013103415 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 13103415 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.06, others allele: 0.00, population size: 113. )
ATAAACGGGGTAGCGCACGAGATTTAAAAGTGGATGGATGCGGAGACAATAAATTTTAGACAGTTCAGACCCTCTCAATGAGAGACAATACCCTAATCTT[G/A]
TTTGAGGATTTGAATCCGCCGGGTTGTGTATTGATCTAACGATCTGAGTTGTAATTCTATATGCTCATGCCCCTTAGAGGGGGCTCCCTGCCCACCTTAT
ATAAGGTGGGCAGGGAGCCCCCTCTAAGGGGCATGAGCATATAGAATTACAACTCAGATCGTTAGATCAATACACAACCCGGCGGATTCAAATCCTCAAA[C/T]
AAGATTAGGGTATTGTCTCTCATTGAGAGGGTCTGAACTGTCTAAAATTTATTGTCTCCGCATCCATCCACTTTTAAATCTCGTGCGCTACCCCGTTTAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.80% | 16.00% | 0.23% | 0.00% | NA |
| All Indica | 2759 | 83.10% | 16.60% | 0.25% | 0.00% | NA |
| All Japonica | 1512 | 81.60% | 18.30% | 0.07% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 38.50% | 61.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.20% | 2.40% | 0.43% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 89.10% | 10.30% | 0.64% | 0.00% | NA |
| Temperate Japonica | 767 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 59.50% | 40.30% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 77.60% | 22.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 91.70% | 7.30% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 84.40% | 13.30% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1013103415 | G -> A | LOC_Os10g25340.1 | upstream_gene_variant ; 1324.0bp to feature; MODIFIER | silent_mutation | Average:56.972; most accessible tissue: Zhenshan97 root, score: 68.289 | N | N | N | N |
| vg1013103415 | G -> A | LOC_Os10g25330.1 | downstream_gene_variant ; 1926.0bp to feature; MODIFIER | silent_mutation | Average:56.972; most accessible tissue: Zhenshan97 root, score: 68.289 | N | N | N | N |
| vg1013103415 | G -> A | LOC_Os10g25330-LOC_Os10g25340 | intergenic_region ; MODIFIER | silent_mutation | Average:56.972; most accessible tissue: Zhenshan97 root, score: 68.289 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1013103415 | NA | 3.52E-12 | mr1026 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013103415 | NA | 9.81E-10 | mr1161 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013103415 | 8.80E-08 | NA | mr1533 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013103415 | 3.43E-07 | 1.87E-14 | mr1533 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013103415 | NA | 1.81E-08 | mr1565 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013103415 | 1.22E-07 | NA | mr1980 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013103415 | NA | 1.60E-13 | mr1980 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013103415 | 2.75E-12 | NA | mr1533_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013103415 | 8.09E-09 | 1.57E-20 | mr1533_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013103415 | NA | 6.74E-07 | mr1745_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013103415 | NA | 6.76E-06 | mr1843_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013103415 | NA | 4.17E-07 | mr1904_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013103415 | 6.72E-06 | NA | mr1980_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013103415 | NA | 4.56E-09 | mr1980_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |