\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1013103415:

Variant ID: vg1013103415 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 13103415
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.06, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


ATAAACGGGGTAGCGCACGAGATTTAAAAGTGGATGGATGCGGAGACAATAAATTTTAGACAGTTCAGACCCTCTCAATGAGAGACAATACCCTAATCTT[G/A]
TTTGAGGATTTGAATCCGCCGGGTTGTGTATTGATCTAACGATCTGAGTTGTAATTCTATATGCTCATGCCCCTTAGAGGGGGCTCCCTGCCCACCTTAT

Reverse complement sequence

ATAAGGTGGGCAGGGAGCCCCCTCTAAGGGGCATGAGCATATAGAATTACAACTCAGATCGTTAGATCAATACACAACCCGGCGGATTCAAATCCTCAAA[C/T]
AAGATTAGGGTATTGTCTCTCATTGAGAGGGTCTGAACTGTCTAAAATTTATTGTCTCCGCATCCATCCACTTTTAAATCTCGTGCGCTACCCCGTTTAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.80% 16.00% 0.23% 0.00% NA
All Indica  2759 83.10% 16.60% 0.25% 0.00% NA
All Japonica  1512 81.60% 18.30% 0.07% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 38.50% 61.50% 0.00% 0.00% NA
Indica II  465 97.20% 2.40% 0.43% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 89.10% 10.30% 0.64% 0.00% NA
Temperate Japonica  767 97.40% 2.60% 0.00% 0.00% NA
Tropical Japonica  504 59.50% 40.30% 0.20% 0.00% NA
Japonica Intermediate  241 77.60% 22.40% 0.00% 0.00% NA
VI/Aromatic  96 91.70% 7.30% 1.04% 0.00% NA
Intermediate  90 84.40% 13.30% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1013103415 G -> A LOC_Os10g25340.1 upstream_gene_variant ; 1324.0bp to feature; MODIFIER silent_mutation Average:56.972; most accessible tissue: Zhenshan97 root, score: 68.289 N N N N
vg1013103415 G -> A LOC_Os10g25330.1 downstream_gene_variant ; 1926.0bp to feature; MODIFIER silent_mutation Average:56.972; most accessible tissue: Zhenshan97 root, score: 68.289 N N N N
vg1013103415 G -> A LOC_Os10g25330-LOC_Os10g25340 intergenic_region ; MODIFIER silent_mutation Average:56.972; most accessible tissue: Zhenshan97 root, score: 68.289 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1013103415 NA 3.52E-12 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013103415 NA 9.81E-10 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013103415 8.80E-08 NA mr1533 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013103415 3.43E-07 1.87E-14 mr1533 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013103415 NA 1.81E-08 mr1565 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013103415 1.22E-07 NA mr1980 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013103415 NA 1.60E-13 mr1980 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013103415 2.75E-12 NA mr1533_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013103415 8.09E-09 1.57E-20 mr1533_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013103415 NA 6.74E-07 mr1745_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013103415 NA 6.76E-06 mr1843_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013103415 NA 4.17E-07 mr1904_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013103415 6.72E-06 NA mr1980_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013103415 NA 4.56E-09 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251