\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1013054571:

Variant ID: vg1013054571 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 13054571
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTTGACGTGGCAGACGGCGGCTCGACGACGCCGTCTGCCGCTGTCTATAAAAATTGCATTTAGCCCCTTGCCGCTCTCTGGGGCTAAATGCATTTTTCGC[A/G]
GCCCTAAAGAGCATTTGGCTCGTACTTTTTTTTTTTGCATCTGAGCCCCTTGCCACCCTAGGCGGCAAGGGACCCAGATGCAAAAATTACCAGCCAAAAA

Reverse complement sequence

TTTTTGGCTGGTAATTTTTGCATCTGGGTCCCTTGCCGCCTAGGGTGGCAAGGGGCTCAGATGCAAAAAAAAAAAGTACGAGCCAAATGCTCTTTAGGGC[T/C]
GCGAAAAATGCATTTAGCCCCAGAGAGCGGCAAGGGGCTAAATGCAATTTTTATAGACAGCGGCAGACGGCGTCGTCGAGCCGCCGTCTGCCACGTCAAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.50% 16.40% 0.13% 0.00% NA
All Indica  2759 99.80% 0.20% 0.00% 0.00% NA
All Japonica  1512 50.00% 49.60% 0.40% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.50% 0.50% 0.00% 0.00% NA
Temperate Japonica  767 72.00% 27.50% 0.52% 0.00% NA
Tropical Japonica  504 20.20% 79.60% 0.20% 0.00% NA
Japonica Intermediate  241 42.30% 57.30% 0.41% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 81.10% 18.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1013054571 A -> G LOC_Os10g25260.1 upstream_gene_variant ; 991.0bp to feature; MODIFIER silent_mutation Average:83.998; most accessible tissue: Callus, score: 97.282 N N N N
vg1013054571 A -> G LOC_Os10g25270.1 downstream_gene_variant ; 4460.0bp to feature; MODIFIER silent_mutation Average:83.998; most accessible tissue: Callus, score: 97.282 N N N N
vg1013054571 A -> G LOC_Os10g25260-LOC_Os10g25270 intergenic_region ; MODIFIER silent_mutation Average:83.998; most accessible tissue: Callus, score: 97.282 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1013054571 A G -0.01 -0.01 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1013054571 NA 1.88E-09 mr1578 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013054571 NA 8.53E-09 mr1585 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013054571 NA 9.73E-10 mr1668 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013054571 NA 2.93E-19 mr1715 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013054571 NA 2.67E-16 mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013054571 NA 1.74E-07 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013054571 3.00E-06 NA mr1546_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013054571 NA 5.09E-07 mr1668_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013054571 NA 3.71E-10 mr1705_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013054571 NA 6.99E-18 mr1715_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013054571 NA 4.41E-09 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013054571 NA 1.57E-06 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251