\
| Variant ID: vg1012949570 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 12949570 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TTTTTTTAAACTAAACATTTGAGAATTAGTAATGGTTAGAACTTTAGAAGTTTAATGAAATATTAACTTAAGCGTTTTTTTTATCAGAGGAAGTTGTCAA[C/T]
AAAGATAACACGGGTTGATTACTCCCTTATTGATAGAGATAGCCTCCATTTTATAGCACAAAAGATTAGGGGTTGCCCCTCTTTCACGATGTCGACGTTT
AAACGTCGACATCGTGAAAGAGGGGCAACCCCTAATCTTTTGTGCTATAAAATGGAGGCTATCTCTATCAATAAGGGAGTAATCAACCCGTGTTATCTTT[G/A]
TTGACAACTTCCTCTGATAAAAAAAACGCTTAAGTTAATATTTCATTAAACTTCTAAAGTTCTAACCATTACTAATTCTCAAATGTTTAGTTTAAAAAAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.50% | 38.50% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 97.30% | 2.70% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 9.80% | 90.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 9.70% | 90.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 96.80% | 3.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 95.20% | 4.80% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 2.70% | 97.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 17.30% | 82.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 16.60% | 83.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 12.50% | 87.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 41.10% | 58.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1012949570 | C -> T | LOC_Os10g25110.1 | upstream_gene_variant ; 2822.0bp to feature; MODIFIER | silent_mutation | Average:28.824; most accessible tissue: Callus, score: 59.534 | N | N | N | N |
| vg1012949570 | C -> T | LOC_Os10g25110-LOC_Os10g25120 | intergenic_region ; MODIFIER | silent_mutation | Average:28.824; most accessible tissue: Callus, score: 59.534 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1012949570 | NA | 7.66E-06 | mr1450 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012949570 | NA | 3.04E-19 | mr1627 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012949570 | 6.23E-08 | NA | mr1668 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012949570 | NA | 3.22E-23 | mr1943 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012949570 | NA | 8.14E-36 | mr1223_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012949570 | NA | 7.77E-07 | mr1275_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012949570 | 6.85E-06 | NA | mr1438_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012949570 | NA | 2.37E-14 | mr1575_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012949570 | 5.47E-06 | 1.66E-08 | mr1668_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012949570 | NA | 3.80E-22 | mr1698_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012949570 | NA | 3.06E-07 | mr1885_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |