\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1012912242:

Variant ID: vg1012912242 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 12912242
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:


CGTGCGATTACGAGGGTGACGACCTGGATCTCGGGAATCTTGTCTTCGTCTCTCGTTGTTGTCTCGACGCCGATCTCCTCCATCTTCGTCGTTACGGCGA[C/T]
GGCCGTGACTAGTGTTGTCTGGCCCTCGCCGATCATGATCATCGTGGTCTCGGTTATCGTGTGGGCGACTTCCTCGATCATGGCGTCGTGAGGAGACATG

Reverse complement sequence

CATGTCTCCTCACGACGCCATGATCGAGGAAGTCGCCCACACGATAACCGAGACCACGATGATCATGATCGGCGAGGGCCAGACAACACTAGTCACGGCC[G/A]
TCGCCGTAACGACGAAGATGGAGGAGATCGGCGTCGAGACAACAACGAGAGACGAAGACAAGATTCCCGAGATCCAGGTCGTCACCCTCGTAATCGCACG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.00% 0.50% 5.56% 1.93% NA
All Indica  2759 98.50% 0.10% 0.69% 0.72% NA
All Japonica  1512 99.30% 0.10% 0.53% 0.00% NA
Aus  269 13.80% 4.10% 56.13% 26.02% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 98.90% 0.20% 0.43% 0.43% NA
Indica III  913 97.90% 0.00% 0.99% 1.10% NA
Indica Intermediate  786 97.80% 0.10% 1.02% 1.02% NA
Temperate Japonica  767 99.60% 0.10% 0.26% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 97.10% 0.40% 2.49% 0.00% NA
VI/Aromatic  96 14.60% 7.30% 78.12% 0.00% NA
Intermediate  90 86.70% 1.10% 11.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1012912242 C -> T LOC_Os10g25080.1 missense_variant ; p.Arg434His; MODERATE nonsynonymous_codon ; R434H Average:68.277; most accessible tissue: Minghui63 flag leaf, score: 84.227 unknown unknown TOLERATED 0.16
vg1012912242 C -> DEL LOC_Os10g25080.1 N frameshift_variant Average:68.277; most accessible tissue: Minghui63 flag leaf, score: 84.227 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1012912242 NA 1.21E-06 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012912242 NA 2.24E-07 mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012912242 NA 5.28E-08 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012912242 4.23E-08 NA mr1134 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012912242 NA 1.72E-12 mr1231 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012912242 NA 1.44E-07 mr1262 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012912242 NA 3.31E-08 mr1415 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012912242 NA 5.27E-08 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012912242 NA 1.42E-13 mr1522 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012912242 NA 3.31E-08 mr1567 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012912242 NA 4.56E-10 mr1585 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012912242 NA 1.80E-07 mr1652 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012912242 NA 1.44E-06 mr1762 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012912242 NA 1.42E-07 mr1989 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012912242 NA 1.58E-07 mr1126_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012912242 NA 2.02E-06 mr1522_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012912242 NA 5.16E-07 mr1567_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012912242 NA 1.28E-09 mr1612_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251