\
| Variant ID: vg1012875705 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 12875705 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.02, others allele: 0.00, population size: 186. )
AGAGCTGTAGGCCAGTCAAACAATTTCTTTCGTAGAGCTGTAGGCCAGCCAAACAATTTCAACTCTACTTAAAAGGCAATAGAGCATGCTAAAGTTCTTT[C/T]
CCAAAATAAACTAGAGACTTGGAGTTGTGTTTTGGCTGGTTCACAACCCTACTTCAAATCCAACTATTTTAAGTTAAATTTAGAAGTTGAAGACCAAGAT
ATCTTGGTCTTCAACTTCTAAATTTAACTTAAAATAGTTGGATTTGAAGTAGGGTTGTGAACCAGCCAAAACACAACTCCAAGTCTCTAGTTTATTTTGG[G/A]
AAAGAACTTTAGCATGCTCTATTGCCTTTTAAGTAGAGTTGAAATTGTTTGGCTGGCCTACAGCTCTACGAAAGAAATTGTTTGACTGGCCTACAGCTCT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.60% | 39.40% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 95.80% | 4.10% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 9.80% | 90.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 9.30% | 90.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.30% | 0.50% | 0.17% | 0.00% | NA |
| Indica II | 465 | 94.60% | 5.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 96.10% | 3.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 93.60% | 6.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 2.70% | 97.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 17.50% | 82.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 16.20% | 83.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 8.30% | 91.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 44.40% | 55.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1012875705 | C -> T | LOC_Os10g25010.1 | upstream_gene_variant ; 1618.0bp to feature; MODIFIER | silent_mutation | Average:72.289; most accessible tissue: Zhenshan97 flower, score: 87.963 | N | N | N | N |
| vg1012875705 | C -> T | LOC_Os10g25020.1 | downstream_gene_variant ; 3703.0bp to feature; MODIFIER | silent_mutation | Average:72.289; most accessible tissue: Zhenshan97 flower, score: 87.963 | N | N | N | N |
| vg1012875705 | C -> T | LOC_Os10g25010-LOC_Os10g25020 | intergenic_region ; MODIFIER | silent_mutation | Average:72.289; most accessible tissue: Zhenshan97 flower, score: 87.963 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1012875705 | NA | 1.42E-45 | mr1111 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012875705 | NA | 6.46E-13 | mr1657 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012875705 | 3.46E-07 | NA | mr1668 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012875705 | 2.45E-06 | NA | mr1668 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012875705 | NA | 1.18E-08 | mr1827 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012875705 | NA | 3.72E-06 | mr1881 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012875705 | NA | 5.62E-22 | mr1943 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012875705 | NA | 1.01E-50 | mr1144_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012875705 | 8.81E-07 | 2.14E-08 | mr1668_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012875705 | NA | 7.39E-69 | mr1798_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |