Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1012875705:

Variant ID: vg1012875705 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 12875705
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.02, others allele: 0.00, population size: 186. )

Flanking Sequence (100 bp) in Reference Genome:

AGAGCTGTAGGCCAGTCAAACAATTTCTTTCGTAGAGCTGTAGGCCAGCCAAACAATTTCAACTCTACTTAAAAGGCAATAGAGCATGCTAAAGTTCTTT[C/T]
CCAAAATAAACTAGAGACTTGGAGTTGTGTTTTGGCTGGTTCACAACCCTACTTCAAATCCAACTATTTTAAGTTAAATTTAGAAGTTGAAGACCAAGAT

Reverse complement sequence

ATCTTGGTCTTCAACTTCTAAATTTAACTTAAAATAGTTGGATTTGAAGTAGGGTTGTGAACCAGCCAAAACACAACTCCAAGTCTCTAGTTTATTTTGG[G/A]
AAAGAACTTTAGCATGCTCTATTGCCTTTTAAGTAGAGTTGAAATTGTTTGGCTGGCCTACAGCTCTACGAAAGAAATTGTTTGACTGGCCTACAGCTCT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.60%	39.40%	0.02%	0.00%	NA
All Indica	2759	95.80%	4.10%	0.04%	0.00%	NA
All Japonica	1512	9.80%	90.20%	0.00%	0.00%	NA
Aus	269	9.30%	90.70%	0.00%	0.00%	NA
Indica I	595	99.30%	0.50%	0.17%	0.00%	NA
Indica II	465	94.60%	5.40%	0.00%	0.00%	NA
Indica III	913	96.10%	3.90%	0.00%	0.00%	NA
Indica Intermediate	786	93.60%	6.40%	0.00%	0.00%	NA
Temperate Japonica	767	2.70%	97.30%	0.00%	0.00%	NA
Tropical Japonica	504	17.50%	82.50%	0.00%	0.00%	NA
Japonica Intermediate	241	16.20%	83.80%	0.00%	0.00%	NA
VI/Aromatic	96	8.30%	91.70%	0.00%	0.00%	NA
Intermediate	90	44.40%	55.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1012875705	C -> T	LOC_Os10g25010.1	upstream_gene_variant ; 1618.0bp to feature; MODIFIER	silent_mutation	Average:72.289; most accessible tissue: Zhenshan97 flower, score: 87.963	N	N	N	N
vg1012875705	C -> T	LOC_Os10g25020.1	downstream_gene_variant ; 3703.0bp to feature; MODIFIER	silent_mutation	Average:72.289; most accessible tissue: Zhenshan97 flower, score: 87.963	N	N	N	N
vg1012875705	C -> T	LOC_Os10g25010-LOC_Os10g25020	intergenic_region ; MODIFIER	silent_mutation	Average:72.289; most accessible tissue: Zhenshan97 flower, score: 87.963	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1012875705	NA	1.42E-45	mr1111	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012875705	NA	6.46E-13	mr1657	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012875705	3.46E-07	NA	mr1668	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012875705	2.45E-06	NA	mr1668	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012875705	NA	1.18E-08	mr1827	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012875705	NA	3.72E-06	mr1881	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012875705	NA	5.62E-22	mr1943	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012875705	NA	1.01E-50	mr1144_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012875705	8.81E-07	2.14E-08	mr1668_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012875705	NA	7.39E-69	mr1798_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251