Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1012833649:

Variant ID: vg1012833649 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 12833649
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.72, T: 0.29, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:

AAATAGTAAAAATACTGTTCAAATCTGAATTGTTTTTTTCTCAGTGTGTATGTCGAATTTAAACTTGATTTTTGGTGGACTGAGTACTGTCAATTGTTTT[T/C]
AAAACTTTCCACGTCTGTTTGTACTGAATTTAAAAGAAAAAGATACATGAGGAGACATCTCCTATAGGTCTTGTTTGGTTAATCCCCCGAGAGAGAGACT

Reverse complement sequence

AGTCTCTCTCTCGGGGGATTAACCAAACAAGACCTATAGGAGATGTCTCCTCATGTATCTTTTTCTTTTAAATTCAGTACAAACAGACGTGGAAAGTTTT[A/G]
AAAACAATTGACAGTACTCAGTCCACCAAAAATCAAGTTTAAATTCGACATACACACTGAGAAAAAAACAATTCAGATTTGAACAGTATTTTTACTATTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.40%	41.00%	0.61%	0.00%	NA
All Indica	2759	34.90%	64.10%	1.05%	0.00%	NA
All Japonica	1512	90.70%	9.30%	0.00%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	25.50%	72.60%	1.85%	0.00%	NA
Indica II	465	39.60%	59.40%	1.08%	0.00%	NA
Indica III	913	30.30%	69.30%	0.33%	0.00%	NA
Indica Intermediate	786	44.40%	54.30%	1.27%	0.00%	NA
Temperate Japonica	767	97.70%	2.30%	0.00%	0.00%	NA
Tropical Japonica	504	82.70%	17.30%	0.00%	0.00%	NA
Japonica Intermediate	241	85.10%	14.90%	0.00%	0.00%	NA
VI/Aromatic	96	94.80%	5.20%	0.00%	0.00%	NA
Intermediate	90	76.70%	23.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1012833649	T -> C	LOC_Os10g24920.1	upstream_gene_variant ; 1285.0bp to feature; MODIFIER	silent_mutation	Average:67.132; most accessible tissue: Minghui63 root, score: 78.594	N	N	N	N
vg1012833649	T -> C	LOC_Os10g24940.1	upstream_gene_variant ; 2330.0bp to feature; MODIFIER	silent_mutation	Average:67.132; most accessible tissue: Minghui63 root, score: 78.594	N	N	N	N
vg1012833649	T -> C	LOC_Os10g24920-LOC_Os10g24940	intergenic_region ; MODIFIER	silent_mutation	Average:67.132; most accessible tissue: Minghui63 root, score: 78.594	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1012833649	NA	3.77E-06	mr1236	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012833649	NA	3.80E-13	mr1329	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012833649	NA	6.06E-06	mr1418	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012833649	NA	1.03E-06	mr1432	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012833649	NA	8.14E-06	mr1573	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012833649	NA	6.11E-06	mr1641	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012833649	NA	7.68E-09	mr1716	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012833649	NA	2.70E-07	mr1763	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012833649	NA	3.17E-07	mr1836	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012833649	NA	7.86E-06	mr1854	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012833649	NA	5.25E-06	mr1875	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012833649	4.62E-06	4.62E-06	mr1891	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012833649	NA	2.12E-07	mr1925	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012833649	4.28E-08	NA	mr1446_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012833649	4.73E-09	1.94E-12	mr1446_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251