Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1012833374:

Variant ID: vg1012833374 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 12833374
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTACCGCTAAATTATTTGGTTTGGAAGACAAACTTCAAAGTAATTTAAATGACATGTAATTTAAAATGGTGGGATCGGGATAGCTCTGTCATCACACGGG[G/A]
AAAACTATTTTGATATCTAGAGACTTGAGGGGACATCCCCTCATTTATTTAAAAACTATCCGGACGGTTATGAGAAAATCCAAAAAATTTATCAACACAC

Reverse complement sequence

GTGTGTTGATAAATTTTTTGGATTTTCTCATAACCGTCCGGATAGTTTTTAAATAAATGAGGGGATGTCCCCTCAAGTCTCTAGATATCAAAATAGTTTT[C/T]
CCCGTGTGATGACAGAGCTATCCCGATCCCACCATTTTAAATTACATGTCATTTAAATTACTTTGAAGTTTGTCTTCCAAACCAAATAATTTAGCGGTAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.10%	39.60%	1.21%	0.13%	NA
All Indica	2759	36.00%	61.90%	1.96%	0.22%	NA
All Japonica	1512	90.70%	9.30%	0.07%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	27.10%	69.40%	3.53%	0.00%	NA
Indica II	465	40.60%	56.80%	2.58%	0.00%	NA
Indica III	913	31.00%	67.50%	0.88%	0.66%	NA
Indica Intermediate	786	45.70%	52.70%	1.65%	0.00%	NA
Temperate Japonica	767	97.70%	2.30%	0.00%	0.00%	NA
Tropical Japonica	504	82.70%	17.30%	0.00%	0.00%	NA
Japonica Intermediate	241	85.10%	14.50%	0.41%	0.00%	NA
VI/Aromatic	96	94.80%	4.20%	1.04%	0.00%	NA
Intermediate	90	76.70%	22.20%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1012833374	G -> A	LOC_Os10g24920.1	upstream_gene_variant ; 1010.0bp to feature; MODIFIER	silent_mutation	Average:57.238; most accessible tissue: Minghui63 root, score: 65.927	N	N	N	N
vg1012833374	G -> A	LOC_Os10g24940.1	upstream_gene_variant ; 2605.0bp to feature; MODIFIER	silent_mutation	Average:57.238; most accessible tissue: Minghui63 root, score: 65.927	N	N	N	N
vg1012833374	G -> A	LOC_Os10g24920-LOC_Os10g24940	intergenic_region ; MODIFIER	silent_mutation	Average:57.238; most accessible tissue: Minghui63 root, score: 65.927	N	N	N	N
vg1012833374	G -> DEL	N	N	silent_mutation	Average:57.238; most accessible tissue: Minghui63 root, score: 65.927	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1012833374	NA	7.58E-06	mr1212	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012833374	NA	7.63E-06	mr1285	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012833374	NA	1.86E-12	mr1329	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012833374	NA	5.28E-08	mr1716	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012833374	NA	3.53E-07	mr1804	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012833374	NA	9.68E-07	mr1925	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012833374	4.57E-08	NA	mr1446_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012833374	2.17E-08	2.64E-12	mr1446_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251