\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1012827616:

Variant ID: vg1012827616 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 12827616
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.50, T: 0.50, others allele: 0.00, population size: 46. )

Flanking Sequence (100 bp) in Reference Genome:


TTCAAAAGTGAGAGAAGTTTTCTTTTGGATTTTCAAGCACGATGTGTACATTTGTACGAAGTGTGCTTTTTACCACTTTTGTTTTATTTTTTCCAAACAC[T/C]
AAAATATTTTTGATGGGTTTGCCAATGTGTTCATTGAGGGGGAGATTGTAAAATCAAAGGTGTTTTTGATTATTATTCTGTGATGAACAATTGGCATTGG

Reverse complement sequence

CCAATGCCAATTGTTCATCACAGAATAATAATCAAAAACACCTTTGATTTTACAATCTCCCCCTCAATGAACACATTGGCAAACCCATCAAAAATATTTT[A/G]
GTGTTTGGAAAAAATAAAACAAAAGTGGTAAAAAGCACACTTCGTACAAATGTACACATCGTGCTTGAAAATCCAAAAGAAAACTTCTCTCACTTTTGAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 32.60% 27.50% 0.95% 38.85% NA
All Indica  2759 5.10% 32.30% 1.56% 60.96% NA
All Japonica  1512 89.70% 1.40% 0.13% 8.73% NA
Aus  269 0.40% 99.30% 0.00% 0.37% NA
Indica I  595 10.40% 18.30% 2.52% 68.74% NA
Indica II  465 4.90% 37.60% 1.08% 56.34% NA
Indica III  913 1.50% 30.20% 0.99% 67.25% NA
Indica Intermediate  786 5.50% 42.20% 1.78% 50.51% NA
Temperate Japonica  767 96.90% 0.80% 0.00% 2.35% NA
Tropical Japonica  504 83.10% 0.80% 0.20% 15.87% NA
Japonica Intermediate  241 80.90% 4.60% 0.41% 14.11% NA
VI/Aromatic  96 6.20% 91.70% 0.00% 2.08% NA
Intermediate  90 41.10% 37.80% 0.00% 21.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1012827616 T -> C LOC_Os10g24910.1 downstream_gene_variant ; 1151.0bp to feature; MODIFIER silent_mutation Average:7.489; most accessible tissue: Callus, score: 26.506 N N N N
vg1012827616 T -> C LOC_Os10g24920.1 downstream_gene_variant ; 401.0bp to feature; MODIFIER silent_mutation Average:7.489; most accessible tissue: Callus, score: 26.506 N N N N
vg1012827616 T -> C LOC_Os10g24910-LOC_Os10g24920 intergenic_region ; MODIFIER silent_mutation Average:7.489; most accessible tissue: Callus, score: 26.506 N N N N
vg1012827616 T -> DEL N N silent_mutation Average:7.489; most accessible tissue: Callus, score: 26.506 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1012827616 NA 5.87E-06 mr1328 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012827616 NA 6.87E-06 mr1169_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012827616 NA 7.73E-06 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012827616 NA 7.53E-07 mr1446_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012827616 NA 1.66E-09 mr1567_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012827616 NA 1.45E-06 mr1567_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012827616 NA 1.87E-10 mr1806_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012827616 NA 3.20E-14 mr1846_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012827616 NA 8.92E-09 mr1909_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012827616 NA 9.77E-11 mr1921_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012827616 NA 2.84E-06 mr1951_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251