\
| Variant ID: vg1012827616 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 12827616 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.50, T: 0.50, others allele: 0.00, population size: 46. )
TTCAAAAGTGAGAGAAGTTTTCTTTTGGATTTTCAAGCACGATGTGTACATTTGTACGAAGTGTGCTTTTTACCACTTTTGTTTTATTTTTTCCAAACAC[T/C]
AAAATATTTTTGATGGGTTTGCCAATGTGTTCATTGAGGGGGAGATTGTAAAATCAAAGGTGTTTTTGATTATTATTCTGTGATGAACAATTGGCATTGG
CCAATGCCAATTGTTCATCACAGAATAATAATCAAAAACACCTTTGATTTTACAATCTCCCCCTCAATGAACACATTGGCAAACCCATCAAAAATATTTT[A/G]
GTGTTTGGAAAAAATAAAACAAAAGTGGTAAAAAGCACACTTCGTACAAATGTACACATCGTGCTTGAAAATCCAAAAGAAAACTTCTCTCACTTTTGAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 32.60% | 27.50% | 0.95% | 38.85% | NA |
| All Indica | 2759 | 5.10% | 32.30% | 1.56% | 60.96% | NA |
| All Japonica | 1512 | 89.70% | 1.40% | 0.13% | 8.73% | NA |
| Aus | 269 | 0.40% | 99.30% | 0.00% | 0.37% | NA |
| Indica I | 595 | 10.40% | 18.30% | 2.52% | 68.74% | NA |
| Indica II | 465 | 4.90% | 37.60% | 1.08% | 56.34% | NA |
| Indica III | 913 | 1.50% | 30.20% | 0.99% | 67.25% | NA |
| Indica Intermediate | 786 | 5.50% | 42.20% | 1.78% | 50.51% | NA |
| Temperate Japonica | 767 | 96.90% | 0.80% | 0.00% | 2.35% | NA |
| Tropical Japonica | 504 | 83.10% | 0.80% | 0.20% | 15.87% | NA |
| Japonica Intermediate | 241 | 80.90% | 4.60% | 0.41% | 14.11% | NA |
| VI/Aromatic | 96 | 6.20% | 91.70% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 41.10% | 37.80% | 0.00% | 21.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1012827616 | T -> C | LOC_Os10g24910.1 | downstream_gene_variant ; 1151.0bp to feature; MODIFIER | silent_mutation | Average:7.489; most accessible tissue: Callus, score: 26.506 | N | N | N | N |
| vg1012827616 | T -> C | LOC_Os10g24920.1 | downstream_gene_variant ; 401.0bp to feature; MODIFIER | silent_mutation | Average:7.489; most accessible tissue: Callus, score: 26.506 | N | N | N | N |
| vg1012827616 | T -> C | LOC_Os10g24910-LOC_Os10g24920 | intergenic_region ; MODIFIER | silent_mutation | Average:7.489; most accessible tissue: Callus, score: 26.506 | N | N | N | N |
| vg1012827616 | T -> DEL | N | N | silent_mutation | Average:7.489; most accessible tissue: Callus, score: 26.506 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1012827616 | NA | 5.87E-06 | mr1328 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012827616 | NA | 6.87E-06 | mr1169_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012827616 | NA | 7.73E-06 | mr1236_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012827616 | NA | 7.53E-07 | mr1446_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012827616 | NA | 1.66E-09 | mr1567_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012827616 | NA | 1.45E-06 | mr1567_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012827616 | NA | 1.87E-10 | mr1806_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012827616 | NA | 3.20E-14 | mr1846_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012827616 | NA | 8.92E-09 | mr1909_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012827616 | NA | 9.77E-11 | mr1921_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012827616 | NA | 2.84E-06 | mr1951_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |