\
| Variant ID: vg1012753141 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 12753141 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GGGGGAGTTCCTTCTGGTTAGCGCAACCGAGTAGTGCAAAGGGCACCTAGTATTGTGTGATTCTCTTGTAGAATCATTGTTTAGAATAGGATGAGGTTCA[T/A]
TGCTTGAGAAGAGTTGAGTTCTGAACTGAACCTACGGCTTTGAGGCTATCTTTACATTTTACCTGTTAGATGAATTCAGTTCAAATGTCCAAAGCGCCAT
ATGGCGCTTTGGACATTTGAACTGAATTCATCTAACAGGTAAAATGTAAAGATAGCCTCAAAGCCGTAGGTTCAGTTCAGAACTCAACTCTTCTCAAGCA[A/T]
TGAACCTCATCCTATTCTAAACAATGATTCTACAAGAGAATCACACAATACTAGGTGCCCTTTGCACTACTCGGTTGCGCTAACCAGAAGGAACTCCCCC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 99.60% | 0.30% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 98.70% | 1.00% | 0.33% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 97.50% | 2.00% | 0.52% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1012753141 | T -> A | LOC_Os10g24800.1 | upstream_gene_variant ; 769.0bp to feature; MODIFIER | N | Average:46.301; most accessible tissue: Zhenshan97 root, score: 73.143 | N | N | N | N |
| vg1012753141 | T -> A | LOC_Os10g24790.1 | downstream_gene_variant ; 1301.0bp to feature; MODIFIER | N | Average:46.301; most accessible tissue: Zhenshan97 root, score: 73.143 | N | N | N | N |
| vg1012753141 | T -> A | LOC_Os10g24810.1 | downstream_gene_variant ; 2257.0bp to feature; MODIFIER | N | Average:46.301; most accessible tissue: Zhenshan97 root, score: 73.143 | N | N | N | N |
| vg1012753141 | T -> A | LOC_Os10g24790-LOC_Os10g24800 | intergenic_region ; MODIFIER | N | Average:46.301; most accessible tissue: Zhenshan97 root, score: 73.143 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1012753141 | 2.81E-09 | 4.80E-11 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012753141 | 1.98E-08 | 1.80E-10 | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012753141 | 4.75E-10 | 2.71E-13 | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012753141 | 1.02E-08 | 1.59E-10 | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012753141 | 2.34E-06 | 2.34E-06 | mr1649 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012753141 | NA | 6.08E-06 | mr1765 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012753141 | 6.43E-10 | 5.57E-12 | mr1305_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012753141 | 2.82E-06 | 5.97E-08 | mr1409_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012753141 | 9.70E-06 | 7.50E-07 | mr1559_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012753141 | 3.80E-09 | 5.76E-13 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012753141 | 3.42E-06 | 3.67E-07 | mr1703_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012753141 | NA | 7.31E-06 | mr1765_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |