\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1012753141:

Variant ID: vg1012753141 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 12753141
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGGGGAGTTCCTTCTGGTTAGCGCAACCGAGTAGTGCAAAGGGCACCTAGTATTGTGTGATTCTCTTGTAGAATCATTGTTTAGAATAGGATGAGGTTCA[T/A]
TGCTTGAGAAGAGTTGAGTTCTGAACTGAACCTACGGCTTTGAGGCTATCTTTACATTTTACCTGTTAGATGAATTCAGTTCAAATGTCCAAAGCGCCAT

Reverse complement sequence

ATGGCGCTTTGGACATTTGAACTGAATTCATCTAACAGGTAAAATGTAAAGATAGCCTCAAAGCCGTAGGTTCAGTTCAGAACTCAACTCTTCTCAAGCA[A/T]
TGAACCTCATCCTATTCTAAACAATGATTCTACAAGAGAATCACACAATACTAGGTGCCCTTTGCACTACTCGGTTGCGCTAACCAGAAGGAACTCCCCC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 99.60% 0.30% 0.11% 0.00% NA
All Indica  2759 100.00% 0.00% 0.00% 0.00% NA
All Japonica  1512 98.70% 1.00% 0.33% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 97.50% 2.00% 0.52% 0.00% NA
Tropical Japonica  504 99.80% 0.00% 0.20% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1012753141 T -> A LOC_Os10g24800.1 upstream_gene_variant ; 769.0bp to feature; MODIFIER N Average:46.301; most accessible tissue: Zhenshan97 root, score: 73.143 N N N N
vg1012753141 T -> A LOC_Os10g24790.1 downstream_gene_variant ; 1301.0bp to feature; MODIFIER N Average:46.301; most accessible tissue: Zhenshan97 root, score: 73.143 N N N N
vg1012753141 T -> A LOC_Os10g24810.1 downstream_gene_variant ; 2257.0bp to feature; MODIFIER N Average:46.301; most accessible tissue: Zhenshan97 root, score: 73.143 N N N N
vg1012753141 T -> A LOC_Os10g24790-LOC_Os10g24800 intergenic_region ; MODIFIER N Average:46.301; most accessible tissue: Zhenshan97 root, score: 73.143 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1012753141 2.81E-09 4.80E-11 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012753141 1.98E-08 1.80E-10 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012753141 4.75E-10 2.71E-13 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012753141 1.02E-08 1.59E-10 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012753141 2.34E-06 2.34E-06 mr1649 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012753141 NA 6.08E-06 mr1765 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012753141 6.43E-10 5.57E-12 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012753141 2.82E-06 5.97E-08 mr1409_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012753141 9.70E-06 7.50E-07 mr1559_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012753141 3.80E-09 5.76E-13 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012753141 3.42E-06 3.67E-07 mr1703_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012753141 NA 7.31E-06 mr1765_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251