\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1012658092:

Variant ID: vg1012658092 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 12658092
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTGTGTTCACCAAGTACCTCAAGCTCCCAATTATGCTTCTGAATTGAGTTTCCTCCATACATTCTCCTCCCTCCTTTCTCAACTTCAACCGAGCATCCAT[G/A]
GGAGTCTGACATGGATTACAATCCCTCATCCCAGCTTTGTCAAGTATCTTTGCTGCATATGCACCTTGAGACACTGTGATCCCTTCCTTTGCATGTTTCA

Reverse complement sequence

TGAAACATGCAAAGGAAGGGATCACAGTGTCTCAAGGTGCATATGCAGCAAAGATACTTGACAAAGCTGGGATGAGGGATTGTAATCCATGTCAGACTCC[C/T]
ATGGATGCTCGGTTGAAGTTGAGAAAGGAGGGAGGAGAATGTATGGAGGAAACTCAATTCAGAAGCATAATTGGGAGCTTGAGGTACTTGGTGAACACAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.90% 8.20% 0.36% 14.49% NA
All Indica  2759 74.20% 1.50% 0.51% 23.78% NA
All Japonica  1512 99.10% 0.70% 0.00% 0.20% NA
Aus  269 1.90% 90.30% 0.74% 7.06% NA
Indica I  595 95.10% 0.20% 0.17% 4.54% NA
Indica II  465 68.80% 1.10% 0.65% 29.46% NA
Indica III  913 68.30% 1.50% 0.44% 29.68% NA
Indica Intermediate  786 68.40% 2.70% 0.76% 28.12% NA
Temperate Japonica  767 99.50% 0.40% 0.00% 0.13% NA
Tropical Japonica  504 99.80% 0.00% 0.00% 0.20% NA
Japonica Intermediate  241 96.70% 2.90% 0.00% 0.41% NA
VI/Aromatic  96 14.60% 85.40% 0.00% 0.00% NA
Intermediate  90 77.80% 13.30% 1.11% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1012658092 G -> A LOC_Os10g24640.1 downstream_gene_variant ; 432.0bp to feature; MODIFIER silent_mutation Average:35.31; most accessible tissue: Minghui63 flag leaf, score: 49.097 N N N N
vg1012658092 G -> A LOC_Os10g24630-LOC_Os10g24640 intergenic_region ; MODIFIER silent_mutation Average:35.31; most accessible tissue: Minghui63 flag leaf, score: 49.097 N N N N
vg1012658092 G -> DEL N N silent_mutation Average:35.31; most accessible tissue: Minghui63 flag leaf, score: 49.097 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1012658092 NA 3.43E-06 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012658092 NA 5.83E-10 mr1415 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012658092 NA 5.83E-10 mr1567 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012658092 NA 4.95E-09 mr1585 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012658092 NA 1.26E-07 mr1126_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012658092 NA 9.65E-06 mr1522_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012658092 NA 6.59E-09 mr1567_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251