\
| Variant ID: vg1012658092 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 12658092 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTGTGTTCACCAAGTACCTCAAGCTCCCAATTATGCTTCTGAATTGAGTTTCCTCCATACATTCTCCTCCCTCCTTTCTCAACTTCAACCGAGCATCCAT[G/A]
GGAGTCTGACATGGATTACAATCCCTCATCCCAGCTTTGTCAAGTATCTTTGCTGCATATGCACCTTGAGACACTGTGATCCCTTCCTTTGCATGTTTCA
TGAAACATGCAAAGGAAGGGATCACAGTGTCTCAAGGTGCATATGCAGCAAAGATACTTGACAAAGCTGGGATGAGGGATTGTAATCCATGTCAGACTCC[C/T]
ATGGATGCTCGGTTGAAGTTGAGAAAGGAGGGAGGAGAATGTATGGAGGAAACTCAATTCAGAAGCATAATTGGGAGCTTGAGGTACTTGGTGAACACAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 76.90% | 8.20% | 0.36% | 14.49% | NA |
| All Indica | 2759 | 74.20% | 1.50% | 0.51% | 23.78% | NA |
| All Japonica | 1512 | 99.10% | 0.70% | 0.00% | 0.20% | NA |
| Aus | 269 | 1.90% | 90.30% | 0.74% | 7.06% | NA |
| Indica I | 595 | 95.10% | 0.20% | 0.17% | 4.54% | NA |
| Indica II | 465 | 68.80% | 1.10% | 0.65% | 29.46% | NA |
| Indica III | 913 | 68.30% | 1.50% | 0.44% | 29.68% | NA |
| Indica Intermediate | 786 | 68.40% | 2.70% | 0.76% | 28.12% | NA |
| Temperate Japonica | 767 | 99.50% | 0.40% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 99.80% | 0.00% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 96.70% | 2.90% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 14.60% | 85.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 77.80% | 13.30% | 1.11% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1012658092 | G -> A | LOC_Os10g24640.1 | downstream_gene_variant ; 432.0bp to feature; MODIFIER | silent_mutation | Average:35.31; most accessible tissue: Minghui63 flag leaf, score: 49.097 | N | N | N | N |
| vg1012658092 | G -> A | LOC_Os10g24630-LOC_Os10g24640 | intergenic_region ; MODIFIER | silent_mutation | Average:35.31; most accessible tissue: Minghui63 flag leaf, score: 49.097 | N | N | N | N |
| vg1012658092 | G -> DEL | N | N | silent_mutation | Average:35.31; most accessible tissue: Minghui63 flag leaf, score: 49.097 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1012658092 | NA | 3.43E-06 | mr1126 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012658092 | NA | 5.83E-10 | mr1415 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012658092 | NA | 5.83E-10 | mr1567 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012658092 | NA | 4.95E-09 | mr1585 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012658092 | NA | 1.26E-07 | mr1126_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012658092 | NA | 9.65E-06 | mr1522_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012658092 | NA | 6.59E-09 | mr1567_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |