\
| Variant ID: vg1012432216 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 12432216 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, A: 0.08, others allele: 0.00, population size: 63. )
CGGGACAGGCAGGCAGGATTGAGCCCCTAGCAGCAGAACACCAGCCCTGTGCCATGACATCTCGACTACCGGGCCACAGCTCGTGTAGCCTTCATTTGTC[C/A]
TAGAGATGTCCATCGACCCCCGACTTCGTCCACCTCCATCCGTGTACTTTTGTTTATAACCAGTCTGAGCCACAAACTAAGCCTTACCCACTGGACATGT
ACATGTCCAGTGGGTAAGGCTTAGTTTGTGGCTCAGACTGGTTATAAACAAAAGTACACGGATGGAGGTGGACGAAGTCGGGGGTCGATGGACATCTCTA[G/T]
GACAAATGAAGGCTACACGAGCTGTGGCCCGGTAGTCGAGATGTCATGGCACAGGGCTGGTGTTCTGCTGCTAGGGGCTCAATCCTGCCTGCCTGTCCCG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.30% | 44.10% | 0.55% | 0.00% | NA |
| All Indica | 2759 | 30.20% | 69.00% | 0.83% | 0.00% | NA |
| All Japonica | 1512 | 89.80% | 10.10% | 0.07% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 7.60% | 91.40% | 1.01% | 0.00% | NA |
| Indica II | 465 | 37.40% | 61.50% | 1.08% | 0.00% | NA |
| Indica III | 913 | 34.90% | 64.40% | 0.66% | 0.00% | NA |
| Indica Intermediate | 786 | 37.40% | 61.80% | 0.76% | 0.00% | NA |
| Temperate Japonica | 767 | 97.70% | 2.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 81.00% | 19.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 83.40% | 16.20% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 70.00% | 27.80% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1012432216 | C -> A | LOC_Os10g24260.1 | upstream_gene_variant ; 1603.0bp to feature; MODIFIER | silent_mutation | Average:20.185; most accessible tissue: Zhenshan97 panicle, score: 32.308 | N | N | N | N |
| vg1012432216 | C -> A | LOC_Os10g24270.1 | downstream_gene_variant ; 2956.0bp to feature; MODIFIER | silent_mutation | Average:20.185; most accessible tissue: Zhenshan97 panicle, score: 32.308 | N | N | N | N |
| vg1012432216 | C -> A | LOC_Os10g24250-LOC_Os10g24260 | intergenic_region ; MODIFIER | silent_mutation | Average:20.185; most accessible tissue: Zhenshan97 panicle, score: 32.308 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1012432216 | NA | 8.87E-08 | mr1045 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012432216 | NA | 7.74E-07 | mr1053 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012432216 | NA | 1.16E-10 | mr1281 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012432216 | NA | 3.26E-07 | mr1328 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012432216 | NA | 4.83E-07 | mr1446 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012432216 | 1.35E-06 | 9.69E-08 | mr1689 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012432216 | NA | 8.94E-08 | mr1716 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012432216 | NA | 3.27E-09 | mr1770 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012432216 | NA | 7.34E-09 | mr1827 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012432216 | NA | 8.20E-07 | mr1925 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012432216 | NA | 3.10E-06 | mr1371_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012432216 | NA | 4.39E-08 | mr1446_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012432216 | NA | 8.79E-06 | mr1655_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |