\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).


Sorry, variation is wrong, please check.

Detailed information for vg1012432216:

Variant ID: vg1012432216 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 12432216
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, A: 0.08, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:


CGGGACAGGCAGGCAGGATTGAGCCCCTAGCAGCAGAACACCAGCCCTGTGCCATGACATCTCGACTACCGGGCCACAGCTCGTGTAGCCTTCATTTGTC[C/A]
TAGAGATGTCCATCGACCCCCGACTTCGTCCACCTCCATCCGTGTACTTTTGTTTATAACCAGTCTGAGCCACAAACTAAGCCTTACCCACTGGACATGT

Reverse complement sequence

ACATGTCCAGTGGGTAAGGCTTAGTTTGTGGCTCAGACTGGTTATAAACAAAAGTACACGGATGGAGGTGGACGAAGTCGGGGGTCGATGGACATCTCTA[G/T]
GACAAATGAAGGCTACACGAGCTGTGGCCCGGTAGTCGAGATGTCATGGCACAGGGCTGGTGTTCTGCTGCTAGGGGCTCAATCCTGCCTGCCTGTCCCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.30% 44.10% 0.55% 0.00% NA
All Indica  2759 30.20% 69.00% 0.83% 0.00% NA
All Japonica  1512 89.80% 10.10% 0.07% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 7.60% 91.40% 1.01% 0.00% NA
Indica II  465 37.40% 61.50% 1.08% 0.00% NA
Indica III  913 34.90% 64.40% 0.66% 0.00% NA
Indica Intermediate  786 37.40% 61.80% 0.76% 0.00% NA
Temperate Japonica  767 97.70% 2.30% 0.00% 0.00% NA
Tropical Japonica  504 81.00% 19.00% 0.00% 0.00% NA
Japonica Intermediate  241 83.40% 16.20% 0.41% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 70.00% 27.80% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1012432216 C -> A LOC_Os10g24260.1 upstream_gene_variant ; 1603.0bp to feature; MODIFIER silent_mutation Average:20.185; most accessible tissue: Zhenshan97 panicle, score: 32.308 N N N N
vg1012432216 C -> A LOC_Os10g24270.1 downstream_gene_variant ; 2956.0bp to feature; MODIFIER silent_mutation Average:20.185; most accessible tissue: Zhenshan97 panicle, score: 32.308 N N N N
vg1012432216 C -> A LOC_Os10g24250-LOC_Os10g24260 intergenic_region ; MODIFIER silent_mutation Average:20.185; most accessible tissue: Zhenshan97 panicle, score: 32.308 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1012432216 NA 8.87E-08 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012432216 NA 7.74E-07 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012432216 NA 1.16E-10 mr1281 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012432216 NA 3.26E-07 mr1328 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012432216 NA 4.83E-07 mr1446 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012432216 1.35E-06 9.69E-08 mr1689 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012432216 NA 8.94E-08 mr1716 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012432216 NA 3.27E-09 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012432216 NA 7.34E-09 mr1827 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012432216 NA 8.20E-07 mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012432216 NA 3.10E-06 mr1371_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012432216 NA 4.39E-08 mr1446_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012432216 NA 8.79E-06 mr1655_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251