\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1012420785:

Variant ID: vg1012420785 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 12420785
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.91, A: 0.07, others allele: 0.00, population size: 45. )

Flanking Sequence (100 bp) in Reference Genome:


CAAGATCGGATGGCTTAGATTGATCTGGCAAGCGAGCCTCACGAGATATCGACTCAACAAGTCAATTCTACGTGACACGGGATCACCGAAATGATCAACC[G/A]
AAACCGGTGAACGAAACTGGCGGCTCTGAACAGCTCCACACGGACGAACGAACGAAGCACGGGGAACACCTCATTTGAACGAACGAGTGAACGACTCAAC

Reverse complement sequence

GTTGAGTCGTTCACTCGTTCGTTCAAATGAGGTGTTCCCCGTGCTTCGTTCGTTCGTCCGTGTGGAGCTGTTCAGAGCCGCCAGTTTCGTTCACCGGTTT[C/T]
GGTTGATCATTTCGGTGATCCCGTGTCACGTAGAATTGACTTGTTGAGTCGATATCTCGTGAGGCTCGCTTGCCAGATCAATCTAAGCCATCCGATCTTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.00% 26.90% 0.87% 0.19% NA
All Indica  2759 72.20% 26.60% 0.80% 0.33% NA
All Japonica  1512 66.90% 32.00% 1.06% 0.00% NA
Aus  269 91.10% 8.90% 0.00% 0.00% NA
Indica I  595 93.30% 6.70% 0.00% 0.00% NA
Indica II  465 65.40% 33.80% 0.86% 0.00% NA
Indica III  913 67.40% 30.90% 0.88% 0.88% NA
Indica Intermediate  786 66.00% 32.60% 1.27% 0.13% NA
Temperate Japonica  767 93.00% 6.90% 0.13% 0.00% NA
Tropical Japonica  504 29.40% 68.50% 2.18% 0.00% NA
Japonica Intermediate  241 62.70% 35.70% 1.66% 0.00% NA
VI/Aromatic  96 94.80% 3.10% 2.08% 0.00% NA
Intermediate  90 68.90% 30.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1012420785 G -> A LOC_Os10g24230.1 upstream_gene_variant ; 3185.0bp to feature; MODIFIER silent_mutation Average:46.427; most accessible tissue: Minghui63 young leaf, score: 66.656 N N N N
vg1012420785 G -> A LOC_Os10g24240.1 downstream_gene_variant ; 1672.0bp to feature; MODIFIER silent_mutation Average:46.427; most accessible tissue: Minghui63 young leaf, score: 66.656 N N N N
vg1012420785 G -> A LOC_Os10g24250.1 downstream_gene_variant ; 2292.0bp to feature; MODIFIER silent_mutation Average:46.427; most accessible tissue: Minghui63 young leaf, score: 66.656 N N N N
vg1012420785 G -> A LOC_Os10g24240-LOC_Os10g24250 intergenic_region ; MODIFIER silent_mutation Average:46.427; most accessible tissue: Minghui63 young leaf, score: 66.656 N N N N
vg1012420785 G -> DEL N N silent_mutation Average:46.427; most accessible tissue: Minghui63 young leaf, score: 66.656 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1012420785 NA 4.50E-08 mr1157 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012420785 NA 6.80E-06 mr1157 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012420785 NA 1.60E-07 mr1194 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012420785 NA 4.54E-12 mr1328 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012420785 NA 5.09E-08 mr1328 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012420785 NA 2.06E-10 mr1446 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012420785 NA 1.11E-07 mr1446 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012420785 NA 5.42E-08 mr1825 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012420785 NA 3.05E-10 mr1446_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012420785 8.83E-06 2.76E-09 mr1446_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012420785 NA 1.79E-06 mr1567_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012420785 NA 7.40E-06 mr1706_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251