\
| Variant ID: vg1012420785 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 12420785 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.91, A: 0.07, others allele: 0.00, population size: 45. )
CAAGATCGGATGGCTTAGATTGATCTGGCAAGCGAGCCTCACGAGATATCGACTCAACAAGTCAATTCTACGTGACACGGGATCACCGAAATGATCAACC[G/A]
AAACCGGTGAACGAAACTGGCGGCTCTGAACAGCTCCACACGGACGAACGAACGAAGCACGGGGAACACCTCATTTGAACGAACGAGTGAACGACTCAAC
GTTGAGTCGTTCACTCGTTCGTTCAAATGAGGTGTTCCCCGTGCTTCGTTCGTTCGTCCGTGTGGAGCTGTTCAGAGCCGCCAGTTTCGTTCACCGGTTT[C/T]
GGTTGATCATTTCGGTGATCCCGTGTCACGTAGAATTGACTTGTTGAGTCGATATCTCGTGAGGCTCGCTTGCCAGATCAATCTAAGCCATCCGATCTTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 72.00% | 26.90% | 0.87% | 0.19% | NA |
| All Indica | 2759 | 72.20% | 26.60% | 0.80% | 0.33% | NA |
| All Japonica | 1512 | 66.90% | 32.00% | 1.06% | 0.00% | NA |
| Aus | 269 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 65.40% | 33.80% | 0.86% | 0.00% | NA |
| Indica III | 913 | 67.40% | 30.90% | 0.88% | 0.88% | NA |
| Indica Intermediate | 786 | 66.00% | 32.60% | 1.27% | 0.13% | NA |
| Temperate Japonica | 767 | 93.00% | 6.90% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 29.40% | 68.50% | 2.18% | 0.00% | NA |
| Japonica Intermediate | 241 | 62.70% | 35.70% | 1.66% | 0.00% | NA |
| VI/Aromatic | 96 | 94.80% | 3.10% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 68.90% | 30.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1012420785 | G -> A | LOC_Os10g24230.1 | upstream_gene_variant ; 3185.0bp to feature; MODIFIER | silent_mutation | Average:46.427; most accessible tissue: Minghui63 young leaf, score: 66.656 | N | N | N | N |
| vg1012420785 | G -> A | LOC_Os10g24240.1 | downstream_gene_variant ; 1672.0bp to feature; MODIFIER | silent_mutation | Average:46.427; most accessible tissue: Minghui63 young leaf, score: 66.656 | N | N | N | N |
| vg1012420785 | G -> A | LOC_Os10g24250.1 | downstream_gene_variant ; 2292.0bp to feature; MODIFIER | silent_mutation | Average:46.427; most accessible tissue: Minghui63 young leaf, score: 66.656 | N | N | N | N |
| vg1012420785 | G -> A | LOC_Os10g24240-LOC_Os10g24250 | intergenic_region ; MODIFIER | silent_mutation | Average:46.427; most accessible tissue: Minghui63 young leaf, score: 66.656 | N | N | N | N |
| vg1012420785 | G -> DEL | N | N | silent_mutation | Average:46.427; most accessible tissue: Minghui63 young leaf, score: 66.656 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1012420785 | NA | 4.50E-08 | mr1157 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012420785 | NA | 6.80E-06 | mr1157 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012420785 | NA | 1.60E-07 | mr1194 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012420785 | NA | 4.54E-12 | mr1328 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012420785 | NA | 5.09E-08 | mr1328 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012420785 | NA | 2.06E-10 | mr1446 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012420785 | NA | 1.11E-07 | mr1446 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012420785 | NA | 5.42E-08 | mr1825 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012420785 | NA | 3.05E-10 | mr1446_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012420785 | 8.83E-06 | 2.76E-09 | mr1446_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012420785 | NA | 1.79E-06 | mr1567_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012420785 | NA | 7.40E-06 | mr1706_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |