\
| Variant ID: vg1012400571 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 12400571 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.51, T: 0.47, others allele: 0.00, population size: 45. )
ACTTGATTTAAGTATATATCGACATGGGTATTATATATTGTCAATATCTACAGCCGATCAAGTAGATTTAGTTCTTTCTTACTTATTTATGACTGCCGAT[T/C]
GATGCATACATGACATCGGCTCAAAGATAAATTATATGTCATCGGCATTTAGCCGATCGACTATCATTTATATGATTAATCGCGGTTTCTTTATCTTTGT
ACAAAGATAAAGAAACCGCGATTAATCATATAAATGATAGTCGATCGGCTAAATGCCGATGACATATAATTTATCTTTGAGCCGATGTCATGTATGCATC[A/G]
ATCGGCAGTCATAAATAAGTAAGAAAGAACTAAATCTACTTGATCGGCTGTAGATATTGACAATATATAATACCCATGTCGATATATACTTAAATCAAGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.00% | 29.80% | 0.38% | 7.85% | NA |
| All Indica | 2759 | 97.40% | 0.80% | 0.29% | 1.52% | NA |
| All Japonica | 1512 | 10.80% | 88.60% | 0.00% | 0.53% | NA |
| Aus | 269 | 10.00% | 1.90% | 2.23% | 85.87% | NA |
| Indica I | 595 | 99.50% | 0.20% | 0.34% | 0.00% | NA |
| Indica II | 465 | 98.10% | 1.10% | 0.00% | 0.86% | NA |
| Indica III | 913 | 97.20% | 0.40% | 0.22% | 2.19% | NA |
| Indica Intermediate | 786 | 95.80% | 1.40% | 0.51% | 2.29% | NA |
| Temperate Japonica | 767 | 2.90% | 96.90% | 0.00% | 0.26% | NA |
| Tropical Japonica | 504 | 19.80% | 80.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 17.40% | 80.10% | 0.00% | 2.49% | NA |
| VI/Aromatic | 96 | 8.30% | 7.30% | 3.12% | 81.25% | NA |
| Intermediate | 90 | 47.80% | 37.80% | 1.11% | 13.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1012400571 | T -> C | LOC_Os10g24200.1 | upstream_gene_variant ; 2113.0bp to feature; MODIFIER | silent_mutation | Average:32.827; most accessible tissue: Minghui63 young leaf, score: 56.213 | N | N | N | N |
| vg1012400571 | T -> C | LOC_Os10g24210.1 | upstream_gene_variant ; 4048.0bp to feature; MODIFIER | silent_mutation | Average:32.827; most accessible tissue: Minghui63 young leaf, score: 56.213 | N | N | N | N |
| vg1012400571 | T -> C | LOC_Os10g24200-LOC_Os10g24210 | intergenic_region ; MODIFIER | silent_mutation | Average:32.827; most accessible tissue: Minghui63 young leaf, score: 56.213 | N | N | N | N |
| vg1012400571 | T -> DEL | N | N | silent_mutation | Average:32.827; most accessible tissue: Minghui63 young leaf, score: 56.213 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1012400571 | NA | 9.72E-09 | mr1342 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012400571 | NA | 2.33E-09 | mr1379 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012400571 | NA | 2.70E-21 | mr1416 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012400571 | NA | 3.90E-48 | mr1519 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012400571 | NA | 1.73E-07 | mr1559 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012400571 | NA | 1.23E-42 | mr1591 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012400571 | NA | 1.02E-26 | mr1617 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012400571 | NA | 6.40E-11 | mr1630 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012400571 | NA | 1.17E-09 | mr1663 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012400571 | NA | 2.69E-06 | mr1748 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012400571 | NA | 3.37E-07 | mr1804 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012400571 | NA | 2.10E-27 | mr1024_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012400571 | NA | 4.92E-09 | mr1084_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012400571 | NA | 1.93E-32 | mr1102_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012400571 | NA | 1.14E-10 | mr1198_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012400571 | NA | 2.71E-08 | mr1205_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012400571 | NA | 1.21E-13 | mr1217_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012400571 | NA | 1.59E-37 | mr1223_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012400571 | NA | 1.37E-06 | mr1272_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012400571 | NA | 2.81E-07 | mr1275_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012400571 | NA | 3.66E-21 | mr1298_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012400571 | NA | 2.40E-07 | mr1376_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012400571 | NA | 9.45E-08 | mr1431_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012400571 | NA | 6.00E-16 | mr1575_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012400571 | NA | 1.30E-11 | mr1636_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012400571 | 2.33E-07 | 1.28E-09 | mr1668_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012400571 | NA | 3.64E-22 | mr1698_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012400571 | NA | 1.51E-21 | mr1731_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012400571 | NA | 2.25E-15 | mr1767_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012400571 | NA | 4.02E-35 | mr1873_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012400571 | NA | 1.39E-07 | mr1909_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012400571 | NA | 9.46E-23 | mr1922_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012400571 | 6.71E-06 | 9.34E-25 | mr1924_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012400571 | 4.84E-06 | NA | mr1934_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012400571 | NA | 1.68E-09 | mr1940_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012400571 | NA | 4.23E-44 | mr1944_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012400571 | NA | 3.71E-14 | mr1950_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012400571 | NA | 3.04E-11 | mr1986_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |