\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1012400571:

Variant ID: vg1012400571 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 12400571
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.51, T: 0.47, others allele: 0.00, population size: 45. )

Flanking Sequence (100 bp) in Reference Genome:


ACTTGATTTAAGTATATATCGACATGGGTATTATATATTGTCAATATCTACAGCCGATCAAGTAGATTTAGTTCTTTCTTACTTATTTATGACTGCCGAT[T/C]
GATGCATACATGACATCGGCTCAAAGATAAATTATATGTCATCGGCATTTAGCCGATCGACTATCATTTATATGATTAATCGCGGTTTCTTTATCTTTGT

Reverse complement sequence

ACAAAGATAAAGAAACCGCGATTAATCATATAAATGATAGTCGATCGGCTAAATGCCGATGACATATAATTTATCTTTGAGCCGATGTCATGTATGCATC[A/G]
ATCGGCAGTCATAAATAAGTAAGAAAGAACTAAATCTACTTGATCGGCTGTAGATATTGACAATATATAATACCCATGTCGATATATACTTAAATCAAGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.00% 29.80% 0.38% 7.85% NA
All Indica  2759 97.40% 0.80% 0.29% 1.52% NA
All Japonica  1512 10.80% 88.60% 0.00% 0.53% NA
Aus  269 10.00% 1.90% 2.23% 85.87% NA
Indica I  595 99.50% 0.20% 0.34% 0.00% NA
Indica II  465 98.10% 1.10% 0.00% 0.86% NA
Indica III  913 97.20% 0.40% 0.22% 2.19% NA
Indica Intermediate  786 95.80% 1.40% 0.51% 2.29% NA
Temperate Japonica  767 2.90% 96.90% 0.00% 0.26% NA
Tropical Japonica  504 19.80% 80.20% 0.00% 0.00% NA
Japonica Intermediate  241 17.40% 80.10% 0.00% 2.49% NA
VI/Aromatic  96 8.30% 7.30% 3.12% 81.25% NA
Intermediate  90 47.80% 37.80% 1.11% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1012400571 T -> C LOC_Os10g24200.1 upstream_gene_variant ; 2113.0bp to feature; MODIFIER silent_mutation Average:32.827; most accessible tissue: Minghui63 young leaf, score: 56.213 N N N N
vg1012400571 T -> C LOC_Os10g24210.1 upstream_gene_variant ; 4048.0bp to feature; MODIFIER silent_mutation Average:32.827; most accessible tissue: Minghui63 young leaf, score: 56.213 N N N N
vg1012400571 T -> C LOC_Os10g24200-LOC_Os10g24210 intergenic_region ; MODIFIER silent_mutation Average:32.827; most accessible tissue: Minghui63 young leaf, score: 56.213 N N N N
vg1012400571 T -> DEL N N silent_mutation Average:32.827; most accessible tissue: Minghui63 young leaf, score: 56.213 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1012400571 NA 9.72E-09 mr1342 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400571 NA 2.33E-09 mr1379 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400571 NA 2.70E-21 mr1416 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400571 NA 3.90E-48 mr1519 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400571 NA 1.73E-07 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400571 NA 1.23E-42 mr1591 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400571 NA 1.02E-26 mr1617 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400571 NA 6.40E-11 mr1630 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400571 NA 1.17E-09 mr1663 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400571 NA 2.69E-06 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400571 NA 3.37E-07 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400571 NA 2.10E-27 mr1024_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400571 NA 4.92E-09 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400571 NA 1.93E-32 mr1102_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400571 NA 1.14E-10 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400571 NA 2.71E-08 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400571 NA 1.21E-13 mr1217_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400571 NA 1.59E-37 mr1223_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400571 NA 1.37E-06 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400571 NA 2.81E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400571 NA 3.66E-21 mr1298_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400571 NA 2.40E-07 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400571 NA 9.45E-08 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400571 NA 6.00E-16 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400571 NA 1.30E-11 mr1636_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400571 2.33E-07 1.28E-09 mr1668_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400571 NA 3.64E-22 mr1698_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400571 NA 1.51E-21 mr1731_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400571 NA 2.25E-15 mr1767_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400571 NA 4.02E-35 mr1873_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400571 NA 1.39E-07 mr1909_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400571 NA 9.46E-23 mr1922_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400571 6.71E-06 9.34E-25 mr1924_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400571 4.84E-06 NA mr1934_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400571 NA 1.68E-09 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400571 NA 4.23E-44 mr1944_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400571 NA 3.71E-14 mr1950_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400571 NA 3.04E-11 mr1986_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251