\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1012400207:

Variant ID: vg1012400207 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 12400207
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.51, G: 0.47, others allele: 0.00, population size: 45. )

Flanking Sequence (100 bp) in Reference Genome:


GTTTGATCTGCTAAGTCGTGCTTAGAATTTCGATCTCTAGCCTGCTTTTTGGTTGCCGATTAGGGTAGCATCGGGGTTTCAGCCGATCTTACCAGATTTA[G/A]
CAATATTTATTCTATATGTTTGATTGACATGTTAAATCCGCCCTTTATATTAAGATCTTGCTGCATTTAAGTATATTATGCTTTTGTTTATTATATTCTA

Reverse complement sequence

TAGAATATAATAAACAAAAGCATAATATACTTAAATGCAGCAAGATCTTAATATAAAGGGCGGATTTAACATGTCAATCAAACATATAGAATAAATATTG[C/T]
TAAATCTGGTAAGATCGGCTGAAACCCCGATGCTACCCTAATCGGCAACCAAAAAGCAGGCTAGAGATCGAAATTCTAAGCACGACTTAGCAGATCAAAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.00% 29.70% 0.38% 7.98% NA
All Indica  2759 97.30% 0.80% 0.11% 1.81% NA
All Japonica  1512 10.80% 88.60% 0.07% 0.53% NA
Aus  269 10.40% 1.50% 2.23% 85.87% NA
Indica I  595 99.30% 0.20% 0.34% 0.17% NA
Indica II  465 97.60% 1.30% 0.00% 1.08% NA
Indica III  913 97.00% 0.40% 0.00% 2.52% NA
Indica Intermediate  786 95.90% 1.30% 0.13% 2.67% NA
Temperate Japonica  767 2.90% 96.90% 0.00% 0.26% NA
Tropical Japonica  504 19.80% 80.20% 0.00% 0.00% NA
Japonica Intermediate  241 17.40% 79.70% 0.41% 2.49% NA
VI/Aromatic  96 9.40% 6.20% 5.21% 79.17% NA
Intermediate  90 46.70% 36.70% 3.33% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1012400207 G -> A LOC_Os10g24200.1 upstream_gene_variant ; 1749.0bp to feature; MODIFIER silent_mutation Average:36.34; most accessible tissue: Minghui63 young leaf, score: 54.11 N N N N
vg1012400207 G -> A LOC_Os10g24210.1 upstream_gene_variant ; 4412.0bp to feature; MODIFIER silent_mutation Average:36.34; most accessible tissue: Minghui63 young leaf, score: 54.11 N N N N
vg1012400207 G -> A LOC_Os10g24200-LOC_Os10g24210 intergenic_region ; MODIFIER silent_mutation Average:36.34; most accessible tissue: Minghui63 young leaf, score: 54.11 N N N N
vg1012400207 G -> DEL N N silent_mutation Average:36.34; most accessible tissue: Minghui63 young leaf, score: 54.11 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1012400207 NA 1.04E-25 mr1024 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400207 NA 1.11E-09 mr1379 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400207 NA 7.72E-49 mr1519 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400207 NA 1.56E-07 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400207 NA 2.80E-26 mr1617 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400207 NA 4.13E-10 mr1630 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400207 NA 3.78E-09 mr1663 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400207 NA 2.66E-06 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400207 NA 2.89E-07 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400207 NA 4.75E-27 mr1024_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400207 NA 1.31E-08 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400207 NA 1.30E-31 mr1102_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400207 NA 7.77E-15 mr1148_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400207 NA 1.49E-10 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400207 NA 9.10E-08 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400207 NA 3.36E-13 mr1217_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400207 NA 1.18E-36 mr1223_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400207 NA 2.21E-06 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400207 NA 4.19E-07 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400207 NA 4.52E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400207 NA 4.29E-21 mr1298_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400207 NA 5.80E-16 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400207 NA 1.20E-11 mr1636_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400207 8.48E-08 1.07E-09 mr1668_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400207 NA 8.18E-23 mr1698_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400207 NA 1.81E-21 mr1731_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400207 NA 5.72E-15 mr1767_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400207 NA 1.46E-34 mr1873_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400207 NA 8.65E-23 mr1922_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400207 2.45E-06 8.58E-26 mr1924_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400207 NA 2.62E-09 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400207 NA 1.21E-24 mr1943_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400207 NA 8.18E-44 mr1944_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400207 NA 6.35E-14 mr1950_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400207 NA 1.92E-11 mr1986_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251