\
| Variant ID: vg1012367119 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 12367119 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.94, A: 0.04, others allele: 0.00, population size: 68. )
TAAACCTCCAAGGCAACAACAAACAGAGAACGAAGTTCTATGAAATTTTGGACTTTCCGAGACATCGGACTATCTGATGTTAAATCGGAGTATCCGATAT[T/A]
TTAGAAGCAAAAACTTCGTCCTCAAACAGAGACTCAAGTTCCATGAAATTTCAGAGTCTCTGTGTCATCGGACTATCTGATCCGACATTGGATACTCTGA
TCAGAGTATCCAATGTCGGATCAGATAGTCCGATGACACAGAGACTCTGAAATTTCATGGAACTTGAGTCTCTGTTTGAGGACGAAGTTTTTGCTTCTAA[A/T]
ATATCGGATACTCCGATTTAACATCAGATAGTCCGATGTCTCGGAAAGTCCAAAATTTCATAGAACTTCGTTCTCTGTTTGTTGTTGCCTTGGAGGTTTA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.50% | 16.40% | 0.13% | 0.00% | NA |
| All Indica | 2759 | 73.30% | 26.60% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 91.40% | 8.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 93.30% | 6.60% | 0.17% | 0.00% | NA |
| Indica II | 465 | 67.10% | 32.50% | 0.43% | 0.00% | NA |
| Indica III | 913 | 68.20% | 31.80% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 67.60% | 32.20% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 85.60% | 14.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1012367119 | T -> A | LOC_Os10g24120.1 | upstream_gene_variant ; 4283.0bp to feature; MODIFIER | silent_mutation | Average:28.367; most accessible tissue: Minghui63 flag leaf, score: 44.406 | N | N | N | N |
| vg1012367119 | T -> A | LOC_Os10g24140.1 | upstream_gene_variant ; 2109.0bp to feature; MODIFIER | silent_mutation | Average:28.367; most accessible tissue: Minghui63 flag leaf, score: 44.406 | N | N | N | N |
| vg1012367119 | T -> A | LOC_Os10g24150.1 | downstream_gene_variant ; 2294.0bp to feature; MODIFIER | silent_mutation | Average:28.367; most accessible tissue: Minghui63 flag leaf, score: 44.406 | N | N | N | N |
| vg1012367119 | T -> A | LOC_Os10g24140-LOC_Os10g24150 | intergenic_region ; MODIFIER | silent_mutation | Average:28.367; most accessible tissue: Minghui63 flag leaf, score: 44.406 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1012367119 | NA | 3.12E-08 | mr1157 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012367119 | 1.10E-06 | 3.39E-08 | mr1157 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012367119 | 3.83E-06 | 1.30E-10 | mr1328 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012367119 | 2.24E-07 | 1.83E-10 | mr1328 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012367119 | NA | 2.45E-10 | mr1446 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012367119 | 4.79E-07 | 1.47E-09 | mr1446 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012367119 | NA | 7.55E-06 | mr1989 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012367119 | NA | 2.47E-11 | mr1446_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012367119 | NA | 9.59E-08 | mr1446_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |