\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1012367119:

Variant ID: vg1012367119 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 12367119
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.94, A: 0.04, others allele: 0.00, population size: 68. )

Flanking Sequence (100 bp) in Reference Genome:


TAAACCTCCAAGGCAACAACAAACAGAGAACGAAGTTCTATGAAATTTTGGACTTTCCGAGACATCGGACTATCTGATGTTAAATCGGAGTATCCGATAT[T/A]
TTAGAAGCAAAAACTTCGTCCTCAAACAGAGACTCAAGTTCCATGAAATTTCAGAGTCTCTGTGTCATCGGACTATCTGATCCGACATTGGATACTCTGA

Reverse complement sequence

TCAGAGTATCCAATGTCGGATCAGATAGTCCGATGACACAGAGACTCTGAAATTTCATGGAACTTGAGTCTCTGTTTGAGGACGAAGTTTTTGCTTCTAA[A/T]
ATATCGGATACTCCGATTTAACATCAGATAGTCCGATGTCTCGGAAAGTCCAAAATTTCATAGAACTTCGTTCTCTGTTTGTTGTTGCCTTGGAGGTTTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.50% 16.40% 0.13% 0.00% NA
All Indica  2759 73.30% 26.60% 0.18% 0.00% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 91.40% 8.60% 0.00% 0.00% NA
Indica I  595 93.30% 6.60% 0.17% 0.00% NA
Indica II  465 67.10% 32.50% 0.43% 0.00% NA
Indica III  913 68.20% 31.80% 0.00% 0.00% NA
Indica Intermediate  786 67.60% 32.20% 0.25% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 85.60% 14.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1012367119 T -> A LOC_Os10g24120.1 upstream_gene_variant ; 4283.0bp to feature; MODIFIER silent_mutation Average:28.367; most accessible tissue: Minghui63 flag leaf, score: 44.406 N N N N
vg1012367119 T -> A LOC_Os10g24140.1 upstream_gene_variant ; 2109.0bp to feature; MODIFIER silent_mutation Average:28.367; most accessible tissue: Minghui63 flag leaf, score: 44.406 N N N N
vg1012367119 T -> A LOC_Os10g24150.1 downstream_gene_variant ; 2294.0bp to feature; MODIFIER silent_mutation Average:28.367; most accessible tissue: Minghui63 flag leaf, score: 44.406 N N N N
vg1012367119 T -> A LOC_Os10g24140-LOC_Os10g24150 intergenic_region ; MODIFIER silent_mutation Average:28.367; most accessible tissue: Minghui63 flag leaf, score: 44.406 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1012367119 NA 3.12E-08 mr1157 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012367119 1.10E-06 3.39E-08 mr1157 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012367119 3.83E-06 1.30E-10 mr1328 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012367119 2.24E-07 1.83E-10 mr1328 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012367119 NA 2.45E-10 mr1446 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012367119 4.79E-07 1.47E-09 mr1446 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012367119 NA 7.55E-06 mr1989 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012367119 NA 2.47E-11 mr1446_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012367119 NA 9.59E-08 mr1446_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251