\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1012362305:

Variant ID: vg1012362305 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 12362305
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.71, C: 0.29, others allele: 0.00, population size: 31. )

Flanking Sequence (100 bp) in Reference Genome:


GGAGGAAGAGAGCACGTGCGGTAAAATGGCAAGTGTGGCGGTGAAAAGGAAAGATCGGTGGGAATATATAGCTCACCCGGGCGACCGTTCGCCTACCCAC[T/C]
AGTAATAAAGCGCCACGTGTCGCAAGGGTAGGCGAAACGGTAACTTCCCACCGTCCGAGCGGCACAGTAAAAAGCCCACGAAGGGAAAGCCCAACGCAGG

Reverse complement sequence

CCTGCGTTGGGCTTTCCCTTCGTGGGCTTTTTACTGTGCCGCTCGGACGGTGGGAAGTTACCGTTTCGCCTACCCTTGCGACACGTGGCGCTTTATTACT[A/G]
GTGGGTAGGCGAACGGTCGCCCGGGTGAGCTATATATTCCCACCGATCTTTCCTTTTCACCGCCACACTTGCCATTTTACCGCACGTGCTCTCTTCCTCC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 31.70% 0.20% 4.91% 63.25% NA
All Indica  2759 3.60% 0.10% 7.50% 88.73% NA
All Japonica  1512 89.00% 0.00% 0.33% 10.71% NA
Aus  269 2.20% 0.70% 3.35% 93.68% NA
Indica I  595 3.40% 0.00% 1.18% 95.46% NA
Indica II  465 7.10% 0.60% 12.90% 79.35% NA
Indica III  913 1.40% 0.00% 8.11% 90.47% NA
Indica Intermediate  786 4.30% 0.10% 8.40% 87.15% NA
Temperate Japonica  767 97.10% 0.00% 0.13% 2.74% NA
Tropical Japonica  504 80.80% 0.00% 0.60% 18.65% NA
Japonica Intermediate  241 80.10% 0.00% 0.41% 19.50% NA
VI/Aromatic  96 5.20% 2.10% 4.17% 88.54% NA
Intermediate  90 44.40% 1.10% 7.78% 46.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1012362305 T -> C LOC_Os10g24110.1 downstream_gene_variant ; 4192.0bp to feature; MODIFIER silent_mutation Average:15.591; most accessible tissue: Callus, score: 36.607 N N N N
vg1012362305 T -> C LOC_Os10g24140.1 downstream_gene_variant ; 2316.0bp to feature; MODIFIER silent_mutation Average:15.591; most accessible tissue: Callus, score: 36.607 N N N N
vg1012362305 T -> C LOC_Os10g24120.1 intron_variant ; MODIFIER silent_mutation Average:15.591; most accessible tissue: Callus, score: 36.607 N N N N
vg1012362305 T -> DEL N N silent_mutation Average:15.591; most accessible tissue: Callus, score: 36.607 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1012362305 NA 3.77E-06 mr1689 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012362305 NA 2.42E-07 mr1158_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012362305 NA 6.94E-06 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012362305 NA 1.13E-07 mr1369_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012362305 7.16E-07 7.16E-07 mr1419_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012362305 NA 3.00E-06 mr1420_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012362305 NA 1.73E-08 mr1453_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012362305 NA 8.69E-06 mr1467_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012362305 8.79E-06 8.79E-06 mr1488_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012362305 5.61E-06 5.61E-06 mr1506_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012362305 NA 3.20E-06 mr1556_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012362305 6.36E-06 4.85E-07 mr1556_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012362305 NA 1.31E-09 mr1567_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012362305 NA 2.52E-06 mr1633_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012362305 NA 1.07E-11 mr1641_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012362305 NA 1.65E-06 mr1641_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012362305 NA 1.49E-06 mr1706_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012362305 NA 1.87E-06 mr1759_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012362305 NA 5.55E-07 mr1823_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012362305 8.15E-06 8.15E-06 mr1840_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012362305 NA 1.17E-14 mr1846_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012362305 NA 6.72E-06 mr1856_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012362305 NA 7.79E-09 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012362305 NA 4.95E-07 mr1951_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251