| Variant ID: vg1012355269 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 12355269 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.58, T: 0.43, others allele: 0.00, population size: 54. )
AGTTGTCATTTCGACAACAGCTGGCGCCGACCGTGGGGACCTCCGAGCGAAACCACTGAGAGTGAATGCCACCGAGGAAGGTCGTGAAGGAGAAGGTTGC[T/C]
AGGTGGAAGGAAAGCGACGCCGGGCCAGACATGGCCGTCGAGGAGGGAGCAGAGCCTTCGGCGCCCGTGGCCGAAGATGGAGGAGGACCATCTGCTTCCA
TGGAAGCAGATGGTCCTCCTCCATCTTCGGCCACGGGCGCCGAAGGCTCTGCTCCCTCCTCGACGGCCATGTCTGGCCCGGCGTCGCTTTCCTTCCACCT[A/G]
GCAACCTTCTCCTTCACGACCTTCCTCGGTGGCATTCACTCTCAGTGGTTTCGCTCGGAGGTCCCCACGGTCGGCGCCAGCTGTTGTCGAAATGACAACT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.60% | 30.10% | 0.55% | 7.74% | NA |
| All Indica | 2759 | 97.10% | 1.20% | 0.29% | 1.49% | NA |
| All Japonica | 1512 | 10.50% | 88.80% | 0.13% | 0.53% | NA |
| Aus | 269 | 10.00% | 1.10% | 3.35% | 85.50% | NA |
| Indica I | 595 | 99.00% | 0.80% | 0.17% | 0.00% | NA |
| Indica II | 465 | 97.20% | 1.70% | 0.22% | 0.86% | NA |
| Indica III | 913 | 96.80% | 0.70% | 0.33% | 2.19% | NA |
| Indica Intermediate | 786 | 95.80% | 1.70% | 0.38% | 2.16% | NA |
| Temperate Japonica | 767 | 2.50% | 97.00% | 0.26% | 0.26% | NA |
| Tropical Japonica | 504 | 19.40% | 80.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 17.40% | 80.10% | 0.00% | 2.49% | NA |
| VI/Aromatic | 96 | 10.40% | 5.20% | 5.21% | 79.17% | NA |
| Intermediate | 90 | 43.30% | 42.20% | 2.22% | 12.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1012355269 | T -> C | LOC_Os10g24100.1 | upstream_gene_variant ; 1968.0bp to feature; MODIFIER | silent_mutation | Average:59.209; most accessible tissue: Minghui63 flag leaf, score: 79.962 | N | N | N | N |
| vg1012355269 | T -> C | LOC_Os10g24110.1 | upstream_gene_variant ; 340.0bp to feature; MODIFIER | silent_mutation | Average:59.209; most accessible tissue: Minghui63 flag leaf, score: 79.962 | N | N | N | N |
| vg1012355269 | T -> C | LOC_Os10g24120.1 | downstream_gene_variant ; 3486.0bp to feature; MODIFIER | silent_mutation | Average:59.209; most accessible tissue: Minghui63 flag leaf, score: 79.962 | N | N | N | N |
| vg1012355269 | T -> C | LOC_Os10g24100-LOC_Os10g24110 | intergenic_region ; MODIFIER | silent_mutation | Average:59.209; most accessible tissue: Minghui63 flag leaf, score: 79.962 | N | N | N | N |
| vg1012355269 | T -> DEL | N | N | silent_mutation | Average:59.209; most accessible tissue: Minghui63 flag leaf, score: 79.962 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1012355269 | NA | 3.44E-09 | mr1342 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012355269 | NA | 2.26E-10 | mr1379 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012355269 | NA | 1.35E-46 | mr1519 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012355269 | NA | 3.32E-24 | mr1537 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012355269 | NA | 2.82E-07 | mr1559 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012355269 | NA | 4.19E-48 | mr1591 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012355269 | NA | 4.63E-11 | mr1657 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012355269 | NA | 1.64E-10 | mr1819 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012355269 | NA | 2.55E-23 | mr1841 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012355269 | NA | 1.17E-40 | mr1890 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012355269 | NA | 6.23E-08 | mr1668_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012355269 | NA | 2.10E-32 | mr1873_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |