\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1012340629:

Variant ID: vg1012340629 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 12340629
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAGGTTTATAACAAGTTGTTCTCTTCACAATTCCAGCAATCAACATTTCCTCTAATTTCACCACAGCTTCACCACACGAATGGCAGAATTATCATCTTCA[T/A]
ATATCAGTAAGCAGCCCACACGTGTGTGTGCTTGCTTCAAGCATTACATAGAAAATTCTCAGTTAACATTCTTACGACAAAATCACTCCTCTTTTTTAGT

Reverse complement sequence

ACTAAAAAAGAGGAGTGATTTTGTCGTAAGAATGTTAACTGAGAATTTTCTATGTAATGCTTGAAGCAAGCACACACACGTGTGGGCTGCTTACTGATAT[A/T]
TGAAGATGATAATTCTGCCATTCGTGTGGTGAAGCTGTGGTGAAATTAGAGGAAATGTTGATTGCTGGAATTGTGAAGAGAACAACTTGTTATAAACCTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.20% 2.40% 1.86% 32.61% NA
All Indica  2759 54.90% 0.30% 2.17% 42.70% NA
All Japonica  1512 90.50% 0.30% 0.53% 8.73% NA
Aus  269 10.80% 33.80% 3.72% 51.67% NA
Indica I  595 31.80% 0.00% 3.19% 65.04% NA
Indica II  465 83.90% 0.00% 0.00% 16.13% NA
Indica III  913 48.50% 0.00% 1.86% 49.62% NA
Indica Intermediate  786 62.60% 0.90% 3.05% 33.46% NA
Temperate Japonica  767 97.70% 0.10% 0.00% 2.22% NA
Tropical Japonica  504 84.10% 0.20% 1.19% 14.48% NA
Japonica Intermediate  241 80.90% 0.80% 0.83% 17.43% NA
VI/Aromatic  96 10.40% 10.40% 8.33% 70.83% NA
Intermediate  90 71.10% 0.00% 2.22% 26.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1012340629 T -> A LOC_Os10g24094.1 3_prime_UTR_variant ; 116.0bp to feature; MODIFIER silent_mutation Average:38.571; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N
vg1012340629 T -> A LOC_Os10g24094.2 3_prime_UTR_variant ; 116.0bp to feature; MODIFIER silent_mutation Average:38.571; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N
vg1012340629 T -> A LOC_Os10g24080.1 upstream_gene_variant ; 2034.0bp to feature; MODIFIER silent_mutation Average:38.571; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N
vg1012340629 T -> A LOC_Os10g24090.1 upstream_gene_variant ; 2034.0bp to feature; MODIFIER silent_mutation Average:38.571; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N
vg1012340629 T -> A LOC_Os10g24070.1 downstream_gene_variant ; 3793.0bp to feature; MODIFIER silent_mutation Average:38.571; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N
vg1012340629 T -> DEL N N silent_mutation Average:38.571; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1012340629 NA 1.54E-06 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012340629 NA 4.09E-06 mr1262 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012340629 NA 6.02E-09 mr1415 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012340629 NA 6.02E-09 mr1567 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012340629 4.72E-06 NA mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012340629 2.46E-06 NA mr1281_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012340629 NA 2.91E-07 mr1522_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251