Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1012340629:

Variant ID: vg1012340629 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 12340629
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAGGTTTATAACAAGTTGTTCTCTTCACAATTCCAGCAATCAACATTTCCTCTAATTTCACCACAGCTTCACCACACGAATGGCAGAATTATCATCTTCA[T/A]
ATATCAGTAAGCAGCCCACACGTGTGTGTGCTTGCTTCAAGCATTACATAGAAAATTCTCAGTTAACATTCTTACGACAAAATCACTCCTCTTTTTTAGT

Reverse complement sequence

ACTAAAAAAGAGGAGTGATTTTGTCGTAAGAATGTTAACTGAGAATTTTCTATGTAATGCTTGAAGCAAGCACACACACGTGTGGGCTGCTTACTGATAT[A/T]
TGAAGATGATAATTCTGCCATTCGTGTGGTGAAGCTGTGGTGAAATTAGAGGAAATGTTGATTGCTGGAATTGTGAAGAGAACAACTTGTTATAAACCTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.20%	2.40%	1.86%	32.61%	NA
All Indica	2759	54.90%	0.30%	2.17%	42.70%	NA
All Japonica	1512	90.50%	0.30%	0.53%	8.73%	NA
Aus	269	10.80%	33.80%	3.72%	51.67%	NA
Indica I	595	31.80%	0.00%	3.19%	65.04%	NA
Indica II	465	83.90%	0.00%	0.00%	16.13%	NA
Indica III	913	48.50%	0.00%	1.86%	49.62%	NA
Indica Intermediate	786	62.60%	0.90%	3.05%	33.46%	NA
Temperate Japonica	767	97.70%	0.10%	0.00%	2.22%	NA
Tropical Japonica	504	84.10%	0.20%	1.19%	14.48%	NA
Japonica Intermediate	241	80.90%	0.80%	0.83%	17.43%	NA
VI/Aromatic	96	10.40%	10.40%	8.33%	70.83%	NA
Intermediate	90	71.10%	0.00%	2.22%	26.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1012340629	T -> A	LOC_Os10g24094.1	3_prime_UTR_variant ; 116.0bp to feature; MODIFIER	silent_mutation	Average:38.571; most accessible tissue: Minghui63 panicle, score: 73.225	N	N	N	N
vg1012340629	T -> A	LOC_Os10g24094.2	3_prime_UTR_variant ; 116.0bp to feature; MODIFIER	silent_mutation	Average:38.571; most accessible tissue: Minghui63 panicle, score: 73.225	N	N	N	N
vg1012340629	T -> A	LOC_Os10g24080.1	upstream_gene_variant ; 2034.0bp to feature; MODIFIER	silent_mutation	Average:38.571; most accessible tissue: Minghui63 panicle, score: 73.225	N	N	N	N
vg1012340629	T -> A	LOC_Os10g24090.1	upstream_gene_variant ; 2034.0bp to feature; MODIFIER	silent_mutation	Average:38.571; most accessible tissue: Minghui63 panicle, score: 73.225	N	N	N	N
vg1012340629	T -> A	LOC_Os10g24070.1	downstream_gene_variant ; 3793.0bp to feature; MODIFIER	silent_mutation	Average:38.571; most accessible tissue: Minghui63 panicle, score: 73.225	N	N	N	N
vg1012340629	T -> DEL	N	N	silent_mutation	Average:38.571; most accessible tissue: Minghui63 panicle, score: 73.225	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1012340629	NA	1.54E-06	mr1126	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012340629	NA	4.09E-06	mr1262	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012340629	NA	6.02E-09	mr1415	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012340629	NA	6.02E-09	mr1567	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012340629	4.72E-06	NA	mr1829	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012340629	2.46E-06	NA	mr1281_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012340629	NA	2.91E-07	mr1522_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251