\
| Variant ID: vg1012340629 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 12340629 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AAGGTTTATAACAAGTTGTTCTCTTCACAATTCCAGCAATCAACATTTCCTCTAATTTCACCACAGCTTCACCACACGAATGGCAGAATTATCATCTTCA[T/A]
ATATCAGTAAGCAGCCCACACGTGTGTGTGCTTGCTTCAAGCATTACATAGAAAATTCTCAGTTAACATTCTTACGACAAAATCACTCCTCTTTTTTAGT
ACTAAAAAAGAGGAGTGATTTTGTCGTAAGAATGTTAACTGAGAATTTTCTATGTAATGCTTGAAGCAAGCACACACACGTGTGGGCTGCTTACTGATAT[A/T]
TGAAGATGATAATTCTGCCATTCGTGTGGTGAAGCTGTGGTGAAATTAGAGGAAATGTTGATTGCTGGAATTGTGAAGAGAACAACTTGTTATAAACCTT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.20% | 2.40% | 1.86% | 32.61% | NA |
| All Indica | 2759 | 54.90% | 0.30% | 2.17% | 42.70% | NA |
| All Japonica | 1512 | 90.50% | 0.30% | 0.53% | 8.73% | NA |
| Aus | 269 | 10.80% | 33.80% | 3.72% | 51.67% | NA |
| Indica I | 595 | 31.80% | 0.00% | 3.19% | 65.04% | NA |
| Indica II | 465 | 83.90% | 0.00% | 0.00% | 16.13% | NA |
| Indica III | 913 | 48.50% | 0.00% | 1.86% | 49.62% | NA |
| Indica Intermediate | 786 | 62.60% | 0.90% | 3.05% | 33.46% | NA |
| Temperate Japonica | 767 | 97.70% | 0.10% | 0.00% | 2.22% | NA |
| Tropical Japonica | 504 | 84.10% | 0.20% | 1.19% | 14.48% | NA |
| Japonica Intermediate | 241 | 80.90% | 0.80% | 0.83% | 17.43% | NA |
| VI/Aromatic | 96 | 10.40% | 10.40% | 8.33% | 70.83% | NA |
| Intermediate | 90 | 71.10% | 0.00% | 2.22% | 26.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1012340629 | T -> A | LOC_Os10g24094.1 | 3_prime_UTR_variant ; 116.0bp to feature; MODIFIER | silent_mutation | Average:38.571; most accessible tissue: Minghui63 panicle, score: 73.225 | N | N | N | N |
| vg1012340629 | T -> A | LOC_Os10g24094.2 | 3_prime_UTR_variant ; 116.0bp to feature; MODIFIER | silent_mutation | Average:38.571; most accessible tissue: Minghui63 panicle, score: 73.225 | N | N | N | N |
| vg1012340629 | T -> A | LOC_Os10g24080.1 | upstream_gene_variant ; 2034.0bp to feature; MODIFIER | silent_mutation | Average:38.571; most accessible tissue: Minghui63 panicle, score: 73.225 | N | N | N | N |
| vg1012340629 | T -> A | LOC_Os10g24090.1 | upstream_gene_variant ; 2034.0bp to feature; MODIFIER | silent_mutation | Average:38.571; most accessible tissue: Minghui63 panicle, score: 73.225 | N | N | N | N |
| vg1012340629 | T -> A | LOC_Os10g24070.1 | downstream_gene_variant ; 3793.0bp to feature; MODIFIER | silent_mutation | Average:38.571; most accessible tissue: Minghui63 panicle, score: 73.225 | N | N | N | N |
| vg1012340629 | T -> DEL | N | N | silent_mutation | Average:38.571; most accessible tissue: Minghui63 panicle, score: 73.225 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1012340629 | NA | 1.54E-06 | mr1126 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012340629 | NA | 4.09E-06 | mr1262 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012340629 | NA | 6.02E-09 | mr1415 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012340629 | NA | 6.02E-09 | mr1567 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012340629 | 4.72E-06 | NA | mr1829 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012340629 | 2.46E-06 | NA | mr1281_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012340629 | NA | 2.91E-07 | mr1522_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |