\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1012250350:

Variant ID: vg1012250350 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 12250350
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGTGGCATACCTGGCAAATCCTCAGGGAACACATCTGGGTAGTCTTGTACTATTGGGATCTCTTGCAAAGCAACTTGATTTAATGTCAAACCATGAGATC[T/C]
AGGGGAGGACACAAAGAAAGACACTGTTTGCCCATTGCTACTGGTTAAAGTCACCTTTCAGTTAGCACAATCTATAACTCCTCGGTGGCAGGTTAGCCAA

Reverse complement sequence

TTGGCTAACCTGCCACCGAGGAGTTATAGATTGTGCTAACTGAAAGGTGACTTTAACCAGTAGCAATGGGCAAACAGTGTCTTTCTTTGTGTCCTCCCCT[A/G]
GATCTCATGGTTTGACATTAAATCAAGTTGCTTTGCAAGAGATCCCAATAGTACAAGACTACCCAGATGTGTTCCCTGAGGATTTGCCAGGTATGCCACC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.90% 1.00% 18.66% 31.42% NA
All Indica  2759 25.00% 1.70% 28.89% 44.40% NA
All Japonica  1512 91.80% 0.00% 0.79% 7.41% NA
Aus  269 52.80% 0.40% 13.01% 33.83% NA
Indica I  595 10.90% 1.00% 24.03% 64.03% NA
Indica II  465 24.10% 0.90% 30.11% 44.95% NA
Indica III  913 31.50% 2.20% 32.20% 34.06% NA
Indica Intermediate  786 28.50% 2.30% 27.99% 41.22% NA
Temperate Japonica  767 97.10% 0.00% 0.00% 2.87% NA
Tropical Japonica  504 88.30% 0.00% 1.19% 10.52% NA
Japonica Intermediate  241 82.20% 0.00% 2.49% 15.35% NA
VI/Aromatic  96 34.40% 0.00% 26.04% 39.58% NA
Intermediate  90 64.40% 0.00% 14.44% 21.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1012250350 T -> C LOC_Os10g23884.1 downstream_gene_variant ; 1601.0bp to feature; MODIFIER silent_mutation Average:31.287; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N
vg1012250350 T -> C LOC_Os10g23880.1 intron_variant ; MODIFIER silent_mutation Average:31.287; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N
vg1012250350 T -> DEL N N silent_mutation Average:31.287; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1012250350 NA 5.23E-06 mr1066_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012250350 NA 8.30E-06 mr1148_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012250350 NA 1.29E-08 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012250350 NA 5.71E-07 mr1272_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012250350 NA 1.55E-09 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012250350 NA 6.80E-10 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012250350 NA 5.32E-06 mr1551_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012250350 NA 2.07E-07 mr1607_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012250350 NA 3.59E-07 mr1607_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012250350 NA 5.26E-06 mr1637_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012250350 NA 7.04E-07 mr1655_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012250350 NA 1.17E-08 mr1668_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012250350 NA 5.91E-06 mr1679_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012250350 NA 9.11E-06 mr1691_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012250350 NA 5.44E-06 mr1704_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012250350 NA 4.85E-07 mr1720_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012250350 7.90E-06 7.90E-06 mr1819_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012250350 NA 2.51E-09 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012250350 NA 3.29E-06 mr1887_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012250350 1.13E-06 NA mr1980_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012250350 1.98E-06 1.12E-06 mr1980_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251