\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1012245318:

Variant ID: vg1012245318 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 12245318
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, others allele: 0.00, population size: 49. )

Flanking Sequence (100 bp) in Reference Genome:


AAACCAGGAGTCGAATTAATGATCATAGTAATATCATTAATGAGTAGTTTGAGACTAATCACGAAAAATATTGTTAGACCCGCCCATAACCGCGGGCACG[A/G]
CTATTCGAATAGTTTTACTCTAGCCAGAGATATACCACTGTACCCAAAAGACACAGCTCCACGACATGTCACCATGCACCTCAATACCACCACGGTACCT

Reverse complement sequence

AGGTACCGTGGTGGTATTGAGGTGCATGGTGACATGTCGTGGAGCTGTGTCTTTTGGGTACAGTGGTATATCTCTGGCTAGAGTAAAACTATTCGAATAG[T/C]
CGTGCCCGCGGTTATGGGCGGGTCTAACAATATTTTTCGTGATTAGTCTCAAACTACTCATTAATGATATTACTATGATCATTAATTCGACTCCTGGTTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 32.60% 18.00% 1.67% 47.80% NA
All Indica  2759 4.90% 28.90% 2.57% 63.65% NA
All Japonica  1512 89.40% 0.40% 0.07% 10.12% NA
Aus  269 2.20% 9.30% 1.49% 86.99% NA
Indica I  595 8.60% 7.20% 4.03% 80.17% NA
Indica II  465 6.00% 36.30% 2.37% 55.27% NA
Indica III  913 1.50% 34.30% 1.53% 62.65% NA
Indica Intermediate  786 5.20% 34.70% 2.80% 57.25% NA
Temperate Japonica  767 97.10% 0.30% 0.00% 2.61% NA
Tropical Japonica  504 82.10% 0.40% 0.20% 17.26% NA
Japonica Intermediate  241 80.10% 0.80% 0.00% 19.09% NA
VI/Aromatic  96 8.30% 4.20% 0.00% 87.50% NA
Intermediate  90 43.30% 17.80% 3.33% 35.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1012245318 A -> G LOC_Os10g23870.1 upstream_gene_variant ; 3896.0bp to feature; MODIFIER silent_mutation Average:9.969; most accessible tissue: Callus, score: 38.926 N N N N
vg1012245318 A -> G LOC_Os10g23880.1 downstream_gene_variant ; 235.0bp to feature; MODIFIER silent_mutation Average:9.969; most accessible tissue: Callus, score: 38.926 N N N N
vg1012245318 A -> G LOC_Os10g23870-LOC_Os10g23880 intergenic_region ; MODIFIER silent_mutation Average:9.969; most accessible tissue: Callus, score: 38.926 N N N N
vg1012245318 A -> DEL N N silent_mutation Average:9.969; most accessible tissue: Callus, score: 38.926 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1012245318 NA 5.07E-08 mr1157 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012245318 NA 1.33E-06 mr1157 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012245318 2.86E-06 2.26E-10 mr1328 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012245318 5.15E-06 1.52E-08 mr1328 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012245318 NA 3.20E-10 mr1446 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012245318 4.71E-06 3.11E-08 mr1446 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012245318 2.35E-08 3.83E-15 mr1446_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012245318 1.89E-06 8.35E-10 mr1446_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251