\
| Variant ID: vg1012245318 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 12245318 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, others allele: 0.00, population size: 49. )
AAACCAGGAGTCGAATTAATGATCATAGTAATATCATTAATGAGTAGTTTGAGACTAATCACGAAAAATATTGTTAGACCCGCCCATAACCGCGGGCACG[A/G]
CTATTCGAATAGTTTTACTCTAGCCAGAGATATACCACTGTACCCAAAAGACACAGCTCCACGACATGTCACCATGCACCTCAATACCACCACGGTACCT
AGGTACCGTGGTGGTATTGAGGTGCATGGTGACATGTCGTGGAGCTGTGTCTTTTGGGTACAGTGGTATATCTCTGGCTAGAGTAAAACTATTCGAATAG[T/C]
CGTGCCCGCGGTTATGGGCGGGTCTAACAATATTTTTCGTGATTAGTCTCAAACTACTCATTAATGATATTACTATGATCATTAATTCGACTCCTGGTTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 32.60% | 18.00% | 1.67% | 47.80% | NA |
| All Indica | 2759 | 4.90% | 28.90% | 2.57% | 63.65% | NA |
| All Japonica | 1512 | 89.40% | 0.40% | 0.07% | 10.12% | NA |
| Aus | 269 | 2.20% | 9.30% | 1.49% | 86.99% | NA |
| Indica I | 595 | 8.60% | 7.20% | 4.03% | 80.17% | NA |
| Indica II | 465 | 6.00% | 36.30% | 2.37% | 55.27% | NA |
| Indica III | 913 | 1.50% | 34.30% | 1.53% | 62.65% | NA |
| Indica Intermediate | 786 | 5.20% | 34.70% | 2.80% | 57.25% | NA |
| Temperate Japonica | 767 | 97.10% | 0.30% | 0.00% | 2.61% | NA |
| Tropical Japonica | 504 | 82.10% | 0.40% | 0.20% | 17.26% | NA |
| Japonica Intermediate | 241 | 80.10% | 0.80% | 0.00% | 19.09% | NA |
| VI/Aromatic | 96 | 8.30% | 4.20% | 0.00% | 87.50% | NA |
| Intermediate | 90 | 43.30% | 17.80% | 3.33% | 35.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1012245318 | A -> G | LOC_Os10g23870.1 | upstream_gene_variant ; 3896.0bp to feature; MODIFIER | silent_mutation | Average:9.969; most accessible tissue: Callus, score: 38.926 | N | N | N | N |
| vg1012245318 | A -> G | LOC_Os10g23880.1 | downstream_gene_variant ; 235.0bp to feature; MODIFIER | silent_mutation | Average:9.969; most accessible tissue: Callus, score: 38.926 | N | N | N | N |
| vg1012245318 | A -> G | LOC_Os10g23870-LOC_Os10g23880 | intergenic_region ; MODIFIER | silent_mutation | Average:9.969; most accessible tissue: Callus, score: 38.926 | N | N | N | N |
| vg1012245318 | A -> DEL | N | N | silent_mutation | Average:9.969; most accessible tissue: Callus, score: 38.926 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1012245318 | NA | 5.07E-08 | mr1157 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012245318 | NA | 1.33E-06 | mr1157 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012245318 | 2.86E-06 | 2.26E-10 | mr1328 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012245318 | 5.15E-06 | 1.52E-08 | mr1328 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012245318 | NA | 3.20E-10 | mr1446 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012245318 | 4.71E-06 | 3.11E-08 | mr1446 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012245318 | 2.35E-08 | 3.83E-15 | mr1446_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012245318 | 1.89E-06 | 8.35E-10 | mr1446_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |