Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1012244370:

Variant ID: vg1012244370 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 12244370
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 51. )

Flanking Sequence (100 bp) in Reference Genome:

TTCATCGATGTTTCAGCCGGTGAGTTATCTAGACGTTGCATCGGCTTATAAGGATTACATAAATATATAAGTTGGATTTAGCCAATGGCGACAAGGTTTT[C/T]
ACTGTTTAATCTAATCTATGGATTTTATGACATCGGACCTCCAGCCGATGTATACTTTAACCTTCGGATCAGTGCTTATTCTATCTTATCATTGCTAGCC

Reverse complement sequence

GGCTAGCAATGATAAGATAGAATAAGCACTGATCCGAAGGTTAAAGTATACATCGGCTGGAGGTCCGATGTCATAAAATCCATAGATTAGATTAAACAGT[G/A]
AAAACCTTGTCGCCATTGGCTAAATCCAACTTATATATTTATGTAATCCTTATAAGCCGATGCAACGTCTAGATAACTCACCGGCTGAAACATCGATGAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	31.70%	17.80%	0.47%	50.02%	NA
All Indica	2759	3.30%	28.60%	0.62%	67.49%	NA
All Japonica	1512	89.40%	0.40%	0.13%	10.05%	NA
Aus	269	3.30%	9.30%	0.74%	86.62%	NA
Indica I	595	5.90%	7.60%	0.84%	85.71%	NA
Indica II	465	3.70%	35.70%	0.65%	60.00%	NA
Indica III	913	1.00%	33.60%	0.22%	65.17%	NA
Indica Intermediate	786	3.80%	34.50%	0.89%	60.81%	NA
Temperate Japonica	767	97.10%	0.30%	0.00%	2.61%	NA
Tropical Japonica	504	81.90%	0.40%	0.20%	17.46%	NA
Japonica Intermediate	241	80.50%	0.80%	0.41%	18.26%	NA
VI/Aromatic	96	7.30%	4.20%	1.04%	87.50%	NA
Intermediate	90	43.30%	20.00%	0.00%	36.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1012244370	C -> T	LOC_Os10g23870.1	upstream_gene_variant ; 2948.0bp to feature; MODIFIER	silent_mutation	Average:6.043; most accessible tissue: Minghui63 root, score: 13.235	N	N	N	N
vg1012244370	C -> T	LOC_Os10g23880.1	downstream_gene_variant ; 1183.0bp to feature; MODIFIER	silent_mutation	Average:6.043; most accessible tissue: Minghui63 root, score: 13.235	N	N	N	N
vg1012244370	C -> T	LOC_Os10g23870-LOC_Os10g23880	intergenic_region ; MODIFIER	silent_mutation	Average:6.043; most accessible tissue: Minghui63 root, score: 13.235	N	N	N	N
vg1012244370	C -> DEL	N	N	silent_mutation	Average:6.043; most accessible tissue: Minghui63 root, score: 13.235	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1012244370	NA	2.08E-08	mr1157	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012244370	1.99E-06	1.86E-07	mr1157	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012244370	3.53E-07	5.37E-11	mr1328	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012244370	2.09E-07	8.95E-10	mr1328	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012244370	1.50E-06	6.40E-11	mr1446	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012244370	1.55E-07	1.42E-09	mr1446	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012244370	6.47E-06	1.64E-12	mr1446_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012244370	NA	4.48E-09	mr1446_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251