\
| Variant ID: vg1012239875 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 12239875 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
GGTCGCATAAGGCCTGGTCGAATTGCTGTGCCCCAATCGAGCAGGTGATCGTGGGACACCCCGGATCTTTCTTCTTTTCCGGGAGTTTGTGGAGTATGAC[A/G]
TTGCTGCATTGTAACGTCAGCTTGACCACCTCCGTTGTTGGGAGTGGTCTCTTGTTGTTGAGTATGTCCTTCAGATAACAGGCGTATGTCGGCACTTGCA
TGCAAGTGCCGACATACGCCTGTTATCTGAAGGACATACTCAACAACAAGAGACCACTCCCAACAACGGAGGTGGTCAAGCTGACGTTACAATGCAGCAA[T/C]
GTCATACTCCACAAACTCCCGGAAAAGAAGAAAGATCCGGGGTGTCCCACGATCACCTGCTCGATTGGGGCACAGCAATTCGACCAGGCCTTATGCGACC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 31.80% | 17.90% | 0.70% | 49.56% | NA |
| All Indica | 2759 | 3.70% | 28.70% | 0.98% | 66.65% | NA |
| All Japonica | 1512 | 89.40% | 0.50% | 0.33% | 9.79% | NA |
| Aus | 269 | 1.90% | 9.70% | 0.37% | 88.10% | NA |
| Indica I | 595 | 6.70% | 7.40% | 1.68% | 84.20% | NA |
| Indica II | 465 | 3.90% | 36.10% | 0.65% | 59.35% | NA |
| Indica III | 913 | 1.20% | 33.70% | 0.66% | 64.40% | NA |
| Indica Intermediate | 786 | 4.10% | 34.60% | 1.02% | 60.31% | NA |
| Temperate Japonica | 767 | 97.10% | 0.30% | 0.13% | 2.48% | NA |
| Tropical Japonica | 504 | 82.10% | 0.40% | 0.60% | 16.87% | NA |
| Japonica Intermediate | 241 | 80.10% | 1.20% | 0.41% | 18.26% | NA |
| VI/Aromatic | 96 | 8.30% | 4.20% | 0.00% | 87.50% | NA |
| Intermediate | 90 | 42.20% | 20.00% | 0.00% | 37.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1012239875 | A -> G | LOC_Os10g23870.1 | synonymous_variant ; p.Asn101Asn; LOW | synonymous_codon | Average:10.968; most accessible tissue: Callus, score: 25.765 | N | N | N | N |
| vg1012239875 | A -> DEL | LOC_Os10g23870.1 | N | frameshift_variant | Average:10.968; most accessible tissue: Callus, score: 25.765 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1012239875 | NA | 9.01E-08 | mr1157 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012239875 | NA | 3.60E-06 | mr1157 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012239875 | 9.81E-07 | 5.74E-10 | mr1328 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012239875 | 2.23E-06 | 1.36E-08 | mr1328 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012239875 | 1.24E-06 | 1.30E-10 | mr1446 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012239875 | 3.86E-07 | 5.15E-09 | mr1446 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012239875 | NA | 5.21E-07 | mr1236_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012239875 | NA | 9.05E-06 | mr1419_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012239875 | NA | 3.55E-10 | mr1446_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012239875 | NA | 3.42E-07 | mr1446_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012239875 | NA | 4.26E-07 | mr1706_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |