Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1012224763:

Variant ID: vg1012224763 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 12224763
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:

TCTCTTTCTCGGTCGCTTGTTCGCATCAGGTTGCGTTGCCCCGAGTCCCCGACGCCGCATCAGCTATCGGTACTCCCCGTAAAAAAAAGGTTATCGCTAT[G/T]
AGCTGAGCTCGCGTATCAGCTTGTCGTTGCAAGTTGAGCTGTTTAGACGCATAATCCGCATGAGCTATCCTGTCTCAGATTTCGTACCGGTGATATTTGA

Reverse complement sequence

TCAAATATCACCGGTACGAAATCTGAGACAGGATAGCTCATGCGGATTATGCGTCTAAACAGCTCAACTTGCAACGACAAGCTGATACGCGAGCTCAGCT[C/A]
ATAGCGATAACCTTTTTTTTACGGGGAGTACCGATAGCTGATGCGGCGTCGGGGACTCGGGGCAACGCAACCTGATGCGAACAAGCGACCGAGAAAGAGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.10%	2.50%	0.87%	2.50%	NA
All Indica	2759	97.50%	0.50%	0.58%	1.49%	NA
All Japonica	1512	97.60%	0.10%	0.00%	2.31%	NA
Aus	269	38.30%	37.50%	9.29%	14.87%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	94.60%	0.90%	0.99%	3.50%	NA
Indica Intermediate	786	97.50%	0.50%	0.89%	1.15%	NA
Temperate Japonica	767	99.90%	0.00%	0.00%	0.13%	NA
Tropical Japonica	504	94.80%	0.00%	0.00%	5.16%	NA
Japonica Intermediate	241	96.30%	0.40%	0.00%	3.32%	NA
VI/Aromatic	96	97.90%	1.00%	0.00%	1.04%	NA
Intermediate	90	95.60%	3.30%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1012224763	G -> T	LOC_Os10g23840.1	upstream_gene_variant ; 206.0bp to feature; MODIFIER	silent_mutation	Average:73.566; most accessible tissue: Zhenshan97 flag leaf, score: 85.514	N	N	N	N
vg1012224763	G -> T	LOC_Os10g23830.1	downstream_gene_variant ; 383.0bp to feature; MODIFIER	silent_mutation	Average:73.566; most accessible tissue: Zhenshan97 flag leaf, score: 85.514	N	N	N	N
vg1012224763	G -> T	LOC_Os10g23830-LOC_Os10g23840	intergenic_region ; MODIFIER	silent_mutation	Average:73.566; most accessible tissue: Zhenshan97 flag leaf, score: 85.514	N	N	N	N
vg1012224763	G -> DEL	N	N	silent_mutation	Average:73.566; most accessible tissue: Zhenshan97 flag leaf, score: 85.514	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1012224763	G	T	0.24	0.05	0.04	0.07	0.1	0.1

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1012224763	NA	3.35E-06	mr1006	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012224763	NA	4.28E-06	mr1007	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012224763	4.47E-06	NA	mr1010	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012224763	NA	2.77E-06	mr1052	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012224763	NA	4.07E-09	mr1317	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012224763	NA	6.25E-11	mr1612	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012224763	NA	7.26E-14	mr1897	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012224763	NA	3.77E-10	mr1927	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012224763	NA	3.39E-08	mr1989	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251